Skip to main content

Advertisement

Table 1 Primer sequences used for genotyping study by SNaPShot method

From: Association between MKRN3 and LIN28B polymorphisms and precocious puberty

Gene rs number Primer sequence
MKRN3 rs2239669 Fa CCCTTTCCTTGCCTGTGAT
Rb GGGGTTGGCCTTCTCATAG
Gc GAGCTCTGTAGAGGAGCCTC
MKRN3 rs6576457 F TTGCTTCATTCTGCTTTCATTG
R CCCATCTGTGCTGTGTTGTG
G GTATTCCTACTTTGCTGAGAGTA
MKRN3 rs12441827 F TTGCTTCATTCTGCTTTCATTG
R CCCATCTGTGCTGTGTTGTG
G GTTTCTAATAAGAAGCCCTTCTGTC
MKRN3-MAGEL2 locus rs12148769 F CCCTGGTACAGGGTTTCCTT
R TCCAACTCTTGACCTCGTGA
G TGGAATTAAATTATGCATTGTCAA
LIN28B rs314276 F TGAATTAAAACATGTAGCTGCTGA
R TCGTCTTGAATTGCAACCTT
LIN28B rs314280 F TCTGGGGAAAGTGTGTTAAGG
R CGGGCAAACTGTCCTGAT
G GGAAACAARAGCAAAGCGACCCAACT
  1. aForward primer
  2. bReverse primer
  3. cGenotyping primer