Skip to main content

Advertisement

Table 1 Sequences of primer pairs for the amplification of exon segments in Hfr-1 and Hfr-2 genes

From: Development of SNP assays for hessian fly response genes, Hfr-1 and Hfr-2, for marker-assisted selection in wheat breeding

Primer names Primer sequence (5′ to 3′) Amplicon size (bp) Exon Overall outcomes
Hfr-1
 Hfr-1_F1 CCTCAGTCTTTCACCTTGGAGACC 294 I The sequences were poor.
 Hfr-1_R1 CCCGAGGTGCAAACCTTGAGC
 Hfr-1_F2 GGTTTACAGGTTCCAGTTTCAAGG 205 II 7 SNPs occurred randomly across cultivars
 Hfr-1_R2 CACCAGAGGTCTTAAGAAGGAGAG
 Hfr-1_F3 CCGAGTCCGACCAGCTTTCTC 237 III 7 SNPs were detected –some result in no amino acid change, some result in amino acid substitution but did not differentiate any R cultivar from S ones.
 Hfr-1_R3 CTACCGTGTCCTTGTTATCCCCAC
 Hfr-1_F4 CCTTCAGAGATCGTTACGGAAGT 210 IV 8 SNPs were detected. The SNP at nt 883 (AF483596) was found to differentiate some R cultivars from S cultivars (Table 3).
 Hfr-1_R4 CTCCACGTAYTTACCAGCGCAC
Hfr-2
 Hfr-2_F1 GCAAGTACCTAGGTAGCGTGC 340 I 2 SNPs were observed to occur in random.
 Hfr-2_R1 CGTACCTGATGGATAGATTATTGTCC
 Hfr-2_F2a CTTCCGTCCYCAGCAGACAAC 678 II 29 SNPs were detected but were found across both S and R cultivars.
 Hfr-2_R2a GGTGTCATTGGTTGAAGTCATGCTGG
 Hfr-2_F2b CTATGGCGTGGAGTTCAAGCTC 433 II The SNP at nt 1294 (GenBank AY587018) was found to differentiate some R cultivars from S cultivars (Table 3). 16 other SNPs found were not informative.
 Hfr-2_R2b TCTTGTAGGTAACAACCTCTCCTG
  1. Refer to Additional file 1: Table S1 for details of the SNPs observed in the exon fragments of Hfr-1 and Hfr-2 of S and R wheat accessions sequenced