Skip to main content

Advertisement

Table 2 The primer sequences for Real-time PCR

From: Seedless mutant ‘Wuzi Ougan’ (Citrus suavissima Hort. ex Tanaka ‘seedless’) and the wild type were compared by iTRAQ-based quantitative proteomics and integratedly analyzed with transcriptome to improve understanding of male sterility

Gene ID Primer sequence (forward) Primer sequence(reverse)
Ciclev10011520m CTAAGGTTGCACCCACCAAC GGCCTTTCATGTCCACATCC
Ciclev10027912m TGTTCCGAGCTCCAGTTTCT TCTCCTCCAAGTGCCTCAAG
Ciclev10011175m TACTCCGGCATCCGATTTGA CCGCTTGTTTAGAGGCTTCC
Ciclev10025933m CTATGGTTGCCGATGAGCAC GCCTTTGCGAATTTGACAGC
Ciclev10028718m GATGGCAAGCCTACACAAGG CCGCTCTGCTTCAATCCAAA
Ciclev10001726m GGCAACTGCTTCAGCTTCTT ACCTGAACGAAGCAATCGTG
Ciclev10015790m AAGGCCTTCTGCAGAGTGAT TGACCCTCCTGCAGTTCAAT
Ciclev10032081m CGACTGCTTCGTTGAGGTTT TCTGAATCCCTTTCGGCCTT
Ciclev10015870m TGGTGTTGTTTCCTGTGCTG TAAGGGCCTCCAAGCTGAAA
Ciclev10020821m TCACATGCAATGGGACTTGC TGGCTGCAGCTTCAGGATTA
Ciclev10031951m TGATTCATTGTCCCGGTGGA TGCTCGTCTTTGGGAGACAT
Ciclev10029158m CGACAACACCCTATGGAACG GACGGCAGATAGTGACTCCA
Ciclev10031133m TCGTGATGAACCCAAATGCC GGCTGCGTCAGATTTCACTT
Ciclev10013148m TCCACTGTCGCCAACATCAT TTGGGTACCGACAGCTTCTT
Ciclev10015535m GAAGCTCGGGAAAGAAGCTG AGTCTTTAGCGAGGCGAAGA
Ciclev10032697m GGGAAGCCACTTAGCCACTA GAGCTAAGGCGACGATGTTC
Ciclev10031286m CTGAAGCCGAAGCTACCAAC TTCCCGTGCTCTCTTCCTTT
Ciclev10025088m ATTAAGGAGCCAACGGCAAC TACACACCTTCCACCTGACC
GU911361(Citrus sinensis) ATCTGCTGGAAGGTGCTGAG CCAAGCAGCATGAAGATCAA