Skip to main content

Advertisement

Table 1 Primers used to amplify the cDNA and gDNA target of the WAP gene

From: The main WAP isoform usually found in camel milk arises from the usage of an improbable intron cryptic splice site in the precursor to mRNA in which a GC-AG intron occurs

  Position Primer Sequence 5′- > 3′ nta Amplicon sizes Tm, oC
cDNA 5’-UTR Forward ATCTGTCACCTGCCTGCCACCTG 23 557 66
  3’-UTR Reverse TGAAGCTGAGTGGGTTTTTATTAGC 25   60
gDNA intron 2 Forward CAGCTGAGGCTGGCCCGCCTC 21 561 70
  intron 3 Reverse GCTAGTCTGACACCCTCTCTCTA 23   62
  1. a nucleotides