Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Chs copy-specific primers designed in the current study

From: Organization and evolution of the chalcone synthase gene family in bread wheat and relative species

Purpose Name Sequence Amplicon lengh (bp) Annealing temperature (°C)
Copy identification, chromosomal assignment and mapping, RT-PCR Chs-A1 Forward 5’TTGTATTCTGCACCACCTCG3’ 265 62
  Reverse 5’AAGAGTGCCTGACCTACCA3’ 62
Chs-B1 Forward
5’TCGTCGTCGTGGAGGTT3’
256 56
  Reverse
5’TCGGAGCAGACCACCA3’
56
Chs-B2 Forward
5’ATGTATCAGCAGGGCTGT3’
279 54
  Reverse
5’CTCTGAGTCCGGCAGAAT3’
54
Chs-B3 Forward 5’GAAGAGGTACATGCACCTG3’ 481 53
  Reverse
5’CGCACCGACGATCACG3’
57
Chs-D1 Forward
5’GATCACCCACCTTGTATT3’
257 49
  Reverse
5’CGCCTGACCTACCAGT3’
54
Chs-A3 group-specific Chs_gs_A3 Forward
5’CCCACCTCGACTCGCTA3’
409 56
  Reverse 5’GCACTTGACATGTTGCCATATT3’ 54
Sequensing T.durum_A1 Forward_1 5’AGGAAGAGGTACATGCACCTT3’ 567 56
  Reverse_1 5’GATGGCACCCTCTGAGTCT3’ 56
  Forward_2 5’CGCTGGTAGGTCAGGCA3’ 543 57
  Reverse_2 5’CTGGGACACTATGGAGGACAA3’ 56
Reference HvActin Forward 5’TCGCAACTTAGAAGCACTTCCG3’ 130 60
  Reverse 5’AAGTACAGTGTCTGGATTGGAGGG3’ 60