Skip to main content

Table 2 List of primers used to follow the mutation of BoFLC1.C9 gene in parental lines, F1 and segregating F2 by polymerase chain reaction (PCR); and relative expression analysis of the target and Actin genes in quantitative PCR (qPCR)

From: Molecular markers based on sequence variation in BoFLC1.C9 for characterizing early- and late-flowering cabbage genotypes

Gene name Accession number Primer code Sequences (5′→3′) Product size (bp) Marker type References
BoFLC1.C9 Bo9g173400 F7:
R7:
GGAAAGCAACATGGTGATGA
CATGGTGTGAACCAGAGTCC
438 Indel Present study
F:
R:
CTCTACAGCTTCTCCTCCGG
TGTGAACCAGAGTCCAAAGC
119 qPCR Present study
Actin AF044573 1F:
1R:
TTCTCTCTTCCACACGCCAT
CTTGTCCTGCGGGTAATTCG
235 [62]
JQ435879 2F:
2R:
GTCGCTATTCAAGCTGTTCTCT
GAGAGCTTCTCCTTGATGTCTC
251 [63]
XM_013753106 3F:
3R:
ATCACACTTTCTACAATGAGC
TCGTAGATTGGCACAGTGTGAG
241 [64]