Skip to main content

Advertisement

Table 1 Stress responsive genes

From: Functional characterization of Gh_A08G1120 (GH3.5) gene reveal their significant role in enhancing drought and salt stress tolerance in cotton

GENE name Gene ID forward reverse
Pyrroline-5-carboxylate synthase (P5CS) TTGAAATAGTGGACGACGTGGC CTCAGCGCCTAGACCAAATCG
Superoxide dismutase (SOD) CATCTCTCACGCACTCTGTC CCTTAGCCATTTCTGTCTGTG
Myeloblastosis (MYB) TGGGAGTAGAGGAGGAGAAGC TTGAGGTGCCTGTGGATTG