Skip to main content

Table 2 Nucleotide sequences of primers used for CDS cloning, 3′ RACE and RT-qPCR in this study

From: Comparative analyses of the Sox9a-Amh-Cyp19a1a regulatory Cascade in Autotetraploid fish and its diploid parent

Primer nameNucleotide sequence (5′ to 3′)
For CDS cloning
Sox9a-F1ATGAATCTACTAGACCCCTACCT
Sox9a-R1GCTGCTGTGCCCAATGCTG
Amh-F1ATGCTCTTCCACGCAGGATTTTG
Amh-R1CAAAGAGCAAAAGGAGGGTGTCA
Cyp19ala-F1ATGGCAGGTGAACTTCTCCAGCC
Cyp19ala-R1GAGGGCGTTTCTGGGGATGAGC
For 3′ RACE
Sox9a-3′-FCAACTCCTATTACACCCACGCT
Amh − 3′-FCAACAACCACGCCATCCTC
Cyp19ala − 3′-FTGCTCAAACAGAATCCAGAC
 3′-adaptor PrimerCTGATCTAGAGGTACCGGATCC
For RT-qPCR
β-actin-FCATCTACGAGGGTTACGCCC
β-actin-RAATTTCCCTCTCGGCTGTGG
Sox9a-F2TCAATACCCGCACCTCCACAACGCC
Sox9a-R2TGAAGATGGCGTTCGGGGAGATGTG
Amh-F2GGAATTCACCAGTCCTGATAGC
Amh-R2CTGCAGAAGTTCTTGAGTGACG
Cyp19ala-F2TTGACACCTGGCAGACGGTA
Cyp19ala-R2CTGCGATTATCATCTCCAACAC
  1. CDS coding sequence, RACE rapid amplification of cDNA ends, RT-qPCR real-time quantitative polymerase chain reaction