Skip to main content

Table 2 Detailed information of 13 microsatellite loci in Amorphophallus albus

From: Genetic diversity and population structure of Amorphophallus albus, a plant species with extremely small populations (PSESP) endemic to dry-hot valley of Jinsha River

Locus Repeat Ranges of allele sizes Tm(℃) Primer sequence (5′ → 3′)
TR6 (CT)7 126–152 55.4 GCCCCATGTCTCACCTGTAT
     TATGCACATGGCAAAGCCTA
TR7 (CT)7 202–228 55.4 ATTGGAGCAGAATTTGTGGG
     CCCCTCTCTGTGAAGAACCA
TR8 (CT)7 116–128 55.4 TGAACTTGTCTTCTCCCGCT
     ATCGAGGGAGCAATTAGGGT
TR9 (CT)7 143–163 55.4 GGGATTGGAAGAGGAAAGGA
     CATCAGACACCATCGCAAAC
TR17 (GA)10 133–168 58.5 GAGGAACGGTGGTCACTCAT
     CTCTCCCCTCTCTGTTTCGC
TR26 (GA)6 286–318 53.4 TTGATGATTTTTCTGCCGGT
     TGATTGCTGTCTACCCGACA
TR34 (TC)10 208–232 54.4 TGGTGCAAAACAAGGTGGTA
     AATGTGCGACCCACACTACA
TR39 (TC)15 201–227 55.4 GTTGCTGGTAACGAGAAGGC
     TTCAGGGAAAACCGAGAGAA
TR49 (TC)7 275–315 58.5 GCTGCTACCAAGTGAGGAGG
     CCGAACCTTGTTAGCTGAGG
TR52 (TC)8 135–171 57.4 ACAAACTCCACTGCCTGTCC
     CTGCCAAGTGATGACCAGTG
TR54 (TC)9 130–156 54.4 CGTTTTGATTTGATTCACCG
     CGACTCAGACGTGCCGTATT
TR68 (GCT)8 131–202 55.4 GCAAAATCCCAGACCACACT
     CGAAAGTTCTGCCAAGGAAC
TR69 (GGA)6 136–202 58.5 GAGCTCGAACCTGCCTACTG
     TACACTACCGATGCTGTCGC
  1. Tm, annealing temperature