Open Access

Genetic effects of polymorphisms in candidate genes and the QTL region on chicken age at first egg

  • Haiping Xu1,
  • Hua Zeng1,
  • Chenglong Luo2,
  • Dexiang Zhang1,
  • Qian Wang1,
  • Liang Sun1,
  • Lishan Yang1,
  • Min Zhou3,
  • Qinghua Nie1 and
  • Xiquan Zhang1Email author
Contributed equally
BMC Genetics201112:33

DOI: 10.1186/1471-2156-12-33

Received: 25 October 2010

Accepted: 15 April 2011

Published: 15 April 2011

Abstract

Background

The age at first egg (AFE), an important indicator for sexual maturation in female chickens, is controlled by polygenes. Based on our knowledge of reproductive physiology, 6 genes including gonadotrophin releasing hormone-I (GnRH-I), neuropeptide Y (NPY), dopamine D2 receptor (DRD2), vasoactive intestinal polypeptide (VIP), VIP receptor-1 (VIPR-1), and prolactin (PRL), were selected as candidates for influencing AFE. Additionally, the region between ADL0201 and MCW0241 of chromosome Z was chosen as the candidate QTL region according to some QTL databases. The objective of the present study was to investigate the effects of mutations in candidate genes and the QTL region on chicken AFE.

Results

Marker-trait association analysis of 8 mutations in those 6 genes in a Chinese native population found a highly significant association (P < 0.01) between G840327C of the GnRH-I gene with AFE, and it remained significant even with Bonferroni correction. Based on the results of the 2-tailed χ2 test, mutations T32742394C, T32742468C, G32742603A, and C33379782T in the candidate QTL region of chromosome Z were selected for marker-trait association analysis. The haplotypes of T32742394C and T32742468C were significantly associated (P < 0.05) with AFE. Bioinformatics analysis indicated that T32742394C and T32742468C were located in the intron region of the SH3-domain GRB2-like 2 (SH3GL2) gene, which appeared to be associated in the endocytosis and development of the oocyte.

Conclusion

This study found that G840327C of the GnRH-I gene and the haplotypes of T32742394C-T32742468C of the SH3GL2 gene were associated with the chicken AFE.

Background

Sexual maturity is a valuable index in poultry production. Although environmental factors such as body weight, body composition as well as age are critical for the onset of sexual maturity [14], but the trait is also determined by its genetic components. Studies of human showed that 50%-80% of the variation in pubertal timing is determined by genetic factors [5, 6]. The age at first egg (AFE) is one of the direct indicators for sexual maturation in female chickens. Earlier work suggested that the estimated heritability (h2) for AFE ranged from 0.20 to 0.56 in different strains [79]. Although the inheritance of AFE has been studied intensively, very little information is available concerning the molecular aspects. The development of molecular biology tools has allowed investigation of the genetic basis of AFE at the molecular level.

AFE is controlled by polygenes [1012] and the selection of candidate genes was derived mainly from our knowledge of reproductive physiology. Sexual maturation in the chicken is the consequence of a complex cascade of progressive maturational events involving the entire hypothalamic-pituitary-gonadal axis. Gonadotrophin-releasing hormone (GnRH) is the start of the cascade [13]. GnRH, binding with its receptor, stimulates the synthesis and secretion of gonadotrophins [14, 15], which induce steroidogenesis of the gonads, culminating in ovarian follicle growth and ovulation for egg production [16]. Neuropeptide Y (NPY) was found to be involved in the regulation of GnRH secretion via its receptor [14, 17] and the injection of NPY can induce precocious puberty in chicks [18]. Therefore, the GnRH-I and NPY genes were chosen as candidates for chicken AFE in this study. On the other hand, some workers reported that dopamine (DA) might be one of the putative neurotransmitters responsible for the activity of GnRH and had both stimulatory and inhibitory influences on gonadotropin release in birds [1921]. Thus, one of its receptors, dopamine D2 receptor (DRD2), could be a candidate gene for the control of AFE. Kadarmideen found that prolactin (PRL) was one of the major regulators of GnRH and GnRH receptors and thus validated its important role in mammalian reproduction and sexual maturity [22]. In avian, it has been shown that exogenous PRL inhibited LH secretion by reducing GnRH levels in the hypothalamus, which could delay the onset of egg laying [23, 24]. Similarly, the neurotransmitter vasoactive intestinal polypeptide (VIP) was reported to modulate GnRH neurons via VIP receptors in both mammalian and avian species [25, 26]. Thus in this study, VIP and VIP receptor-1 (VIPR-1), as well as PRL were chosen as candidates to analyze the genetic effects on chicken AFE.

To date, a number of QTL studies have been conducted in order to identify QTL affecting chicken AFE [2729]. On the basis of some known chicken QTL databases such as http://www.animalgenome.org/cgi-bin/QTLdb/GG/index, http://chicken.genomics.org.cn/, and http://www.thearkdb.org/arkdb/, several novel QTL affecting AFE were identified on chicken chromosomes 1, 3 and Z [3032]. Tuiskula-Haavisto reported that an area affecting the AFE was located on chromosome Z [28]. Another study found that the QTL region significantly linked with AFE was located between ADL0201 and MCW0241 of chromosome Z [29]. This region is used as the candidate QTL region for AFE in the present study.

The objective of this study was to identify variations that showed an association with chicken AFE in the candidate genes and the candidate QTL region. In this study, a total of 8 mutations in the GnRH-I, NPY, DRD2, VIP, VIPR-I, and PRL genes were chosen for marker-trait association analysis in a Chinese native chicken population. Based on two-tailed χ2 test method, 4 single nucleotide polymorphisms (SNPs) of the candidate QTL region were selected to analyze their associations with AFE.

Methods

Chicken Population and Trait Observation

The Ningdu Sanhuang (NDH) chicken (a Chinese native chicken population from Jiangxi province) possesses markedly early maturity. Generally, NDH males first crow at 80 d of age and the AFE of females is about 133 d of age when reared on the floor. The population used for this study was NDH female chickens from a half-sib population of Guangdong Wens Foodstuff Company Ltd, Guangdong, China, which had been kept as a closed breeding population for five generations. A total of 1, 310 NDH female individuals from one hatch were used in association analysis. Chickens were exposed to light continuously during the first 3 days post hatch, and then to a 16 h light/8 h dark cycle. All individuals were fed ad libitum to 77 d of age with diet for 2, 837 kcal of ME/kg, and then changed to be fed with diet for 2, 907 kcal of ME/kg. From 90 d to 300 d of age, all chickens were shifted into individual laying cages and the AFE trait was recorded. The average value of AFE in this population was 124.3 ± 16.8 d. At 300 d of age, the blood samples of chickens were collected from a vein under the wing of each bird and the genomic DNA was extracted. All animal procedures were performed in accordance with Law of the People's Republic of China on Animal Protection.

According to the AFE record, 24 birds with the earliest AFE and 24 individuals with the latest AFE out of 1, 310 NDH females were chosen for 2-tailed χ2 test in the QTL region. The mean AFE values were 92.5 ± 1.3 d in the early group and 166.4 ± 5.9 d in the late group.

SNP Selection and Primer Design

The SNPs used for genotyping were obtained from two resources: (1) the variations of candidate genes for chicken AFE including the GnRH-I, NPY, DRD2, VIP, VIPR-I, and PRL genes and (2) those located within a QTL region between ADL0201 and MCW0241 (32.17 ~ 34.26 Mb) on chromosome Z.

Eight SNPs from the 6 candidate genes were selected on the basis of information in the dbSNP database http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?CMD=search&DB=snp and earlier reports [3336]. Eight pairs of primers used for SNP genotyping (Table 1) were designed with Genetool software (http://www.biologysoft.com/; BioTools, Alberta, Canada).
Table 1

Primers of mutations in the candidate genes

No.

Sites1

Chr2

Gene

Primer sequence

(5'→3')

Length3 (bp)

AT4(°C)

Restriction enzyme

M1

G840327C

Chr22

GnRH-I

F:tgtcacacccaggatctcaa

R:gctgttcagaggcacgtgag

310

59.0

MnII

M2

C31394761T

Chr2

NPY

F:cgtggctgctttgcttcctttc

R:ggggtacgaggcaaggacatg

324

60.0

Kpn I

M3

T5841629C

Chr24

DRD2

F:tgcacataaaagcccactcactg

R:gcctgagctggtgggggg

248

60.0

BseGI

M4

G51389822T

Chr3

VIP

F:gcttggactgatgcgtactt

R:gtatcactgcaaatgctctgc

520

58.0

Apo I

M5

A1661691G

Chr2

VIPR-1

F:tgaaagcccccaggatct

R:agcaaaacaaaacccaaatca

364

58.2

Tai I

M6

C1704887T

Chr2

VIPR-1

F:ccccgttaaactcagcagac

R:cccaaagtcccacaaggtaa

434

58.2

Hha I

M7

C1715301T

Chr2

VIPR-1

F:ctcctcaggcagaccatcatg

R:cttgcacgtatccttgggtagc

486

58.2

Taq I

M8

I59724210D

Chr2

PRL

F:tttaatattggtgggtgaagagaca

R:atgccactgatcctcgaaaactc

130/154

54.0

PCR

1The sites were based on the chicken genome sequences released in May, 2006 http://genome.ucsc.edu/cgi-bin/hgGateway;

2Chr referred to chromosome;

3Length indicated the length of PCR products;

4AT referred to annealing temperature.

Twelve candidate markers, including 7 from the dbSNP database http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?CMD=search&DB=snp and 5 (M9-M12, and M20) from an earlier scan (data not shown) were selected from the candidate QTL region for 2-tailed test (Table 2). The inclusion criterion for selecting markers was that the average distance between two adjacent markers was about 200 kb. Sites chose by 2-tailed test method were used for the following association analysis of the QTL region. Three pairs of primers (M10 or M11, M12 and M13, Table 2) were designed and synthesized for genotyping these variations in the association analysis.
Table 2

Primers for two-tailed test on the candidate QTL region of chromosome Z

Primer

Primers sequences

(5' →3')

Location1 (nt)/Sites

Length2 (bp)

AT3 (°C)

Restricton enzyme

M9

pyrosequencing

A32173403T

/

/

/

M10

F:aggagctgggtgacattgtg

R:tggggtaaggacagcacagt

T32742394C

721

58

Msp I

M11

F:aggagctgggtgacattgtg

R:tggggtaaggacagcacagt

T32742468C

721

58

PauI

M12

F:tgcaagcccaggaatcatcactc

R:taaaactcttctttccttctaca

G32742603A

294

58

Alu I

M13

F:tcttcgaacacattactcactga

R:ggcgttttgtgttttcttggcat

C33379782T (rs14761596)

400

57

Alu I

M14

pyrosequencing

G33610060A (rs14761431)

/

/

/

M15

pyrosequencing

(ATT)7 33729521(ATT)5 (rs16765989)

/

/

/

M16

pyrosequencing

C33832610T (rs14761267)

/

/

/

M17

pyrosequencing

G33962646T (rs16765930)

/

/

/

M18

pyrosequencing

C34050133T (rs14761127)

/

/

/

M19

pyrosequencing

C34163373T (rs16767050)

/

/

/

M20

pyrosequencing

G34263878A

/

/

/

1Location on chicken Z chromosome; ID in brackets were the refSNP ID based on the dbSNP database http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?CMD=search&DB=snp;

2Length indicated PCR product length;

3AT referred to annealing temperature.

PCR Amplification

The PCR conditions used for amplification were as follows: 50 ng of genomic DNA, 1 μM of each primer, 200 μM dNTP, 1.5 mM MgCl2, 1 × PCR buffer, and 1.0 U Taq DNA polymerase (Sangon Biological Engineering Technology Company, Shanghai, China) in a final volume of 25 μL. The PCR were carried out on an Eppendorf Mastercycler (Eppendorf Limited, Hamburg, Germany) under the following conditions: 94°C for 4 min; 35 cycles of 94°C for 30 s, n°C (n was the annealing temperature shown in Table 1 and 2) for 35 s, 72°C for 35 s; and 72°C for 7 min. The PCR products were separated on 1% (w/v) agarose gel electrophoresis, stained with ethidium bromide and visualized in a TFM-40 Ultraviolet Transilluminator (UVP Company, Cambridge, UK).

Genotyping of Polymorphisms

The 12 markers of the candidate QTL region used for 2-tailed test were genotyped by direct pyrosequencing by the Beijing Genomics Institute (BGI, Shenzhen, China).

Genotyping assays of polymorphisms used for the association analysis were based on the presence or the absence of a restriction site in the PCR-amplified DNA fragments. Genotyping of M8 was performed directly by electrophoresis in a 3.5% agarose gel after PCR amplification. The genotypes of the other sites for marker-trait association analysis were determined by PCR-RFLP method: 7 μL of PCR product was digested with the corresponding restriction enzyme according to the manufacturer's protocol. Digestions were performed overnight at 37°C (BseGI at 55°C, Taq I and Tai I at 65°C). Subsequently, the PCR products were separated by electrophoresis in a 2.5% agarose gel and the genotypes were determined with a TFM-40 Ultraviolet Transilluminator (UVP Company, Cambridge, UK).

Statistical Analyses

Two-tailed χ2Test

Comparisons of genotypes between the early and the late AFE groups were evaluated by a 2-tailed χ2 test and a Bonferoni corrected P-value threshold (P = 0.05/12 = 0.0042) was employed.

Haplotype Inference

The haplotype structure was analyzed with the Haploview v 3.32 software http://www.broad.mit.edu/mpg/haploview/. Haplotypes were constructed with PHASE 2.0 software http://www.stat.washington.edu/stephens/software.html on the basis of the haplotype structure.

Marker-Trait Association Analysis

Association analysis of polymorphisms or haplotypes with AFE was performed with the GLM procedures of SAS 8.0 software (SAS Institute Inc., Cary, NC, USA) using the following model:
https://static-content.springer.com/image/art%3A10.1186%2F1471-2156-12-33/MediaObjects/12863_2010_Article_893_Equa_HTML.gif

Where Y is a trait observation, μ is the overall population mean, G is the effect of genotype or haplotype, S is the fixed effect of sire, and e is the residual error. Multiple comparisons were performed with least squares means by Fisher's least-significance difference method. The values were presented as least square means ± standard error means. The results for the 12 markers (8 in the candidate genes and 4 in the QTL region) were assessed by a Bonferoni 5% significance threshold of P = 0.05/12 = 0.0042 and a Bonferoni 1% great significance threshold of P = 0.01/12 = 0.00083, conservatively assuming the 12 tests to be independent. For the haplotype block in the QTL region, the level of statistically significant difference was set at P < 0.05.

Bioinformatics Analysis

Gene mapping of the sites associated with AFE in the candidate QTL region and analysis of their function were completed by the use of 2 bioinformatic web sites of http://www.ensembl.org/Gallus_gallus/index.html and http://www.ncbi.nlm.nih.gov/mapview/.

Results

Association of Polymorphisms in the 6 Candidate Genes with Chicken AFE

Association of the 8 polymorphisms in the 6 candidate genes with chicken AFE was analyzed and the results were shown in Table 3. A highly significant association (P < 0.01) was found between the SNP G840327C of the chicken GnRH-I gene and AFE. In addition, the mean AFE value of birds with the CC genotype was great significantly higher (P < 0.01) than that of birds with the GC or GG genotype. These effects remained great significant (P < 0.00083) even after Bonferroni correction for multiple testing. Significant associations (P < 0.05) were detected between AFE and 3 SNPs including C31394761T of the NPY gene, T5841629C of the DRD2 gene, and A1661691G of the VIPR-1 gene. Allele C of C31394761T and allele A of A1661691G were positive for chicken AFE. However, all these significant effects disappeared when results were corrected by Bonferroni method for multiple testing (Table 3). No other site was found to be significantly associated with chicken AFE.
Table 3

Association of the SNPs in the candidate genes with chicken AFE

No.

Candidate gene

Sites1

Genotype

N2

AFE3

P value

M1

GnRH-I

G840327C

CC

26

135.1 ± 3.2A

0.0002**

   

GC

208

121.2 ± 1.1B

 
   

GG

972

123.6 ± 0.5B

 

M2

NPY

C31394761T

CC

392

121.5 ± 0.8a

0.0143*

   

TC

600

124.1 ± 0.7b

 
   

TT

214

125.0 ± 1.1b

 

M3

DRD2

T5841629C

CC

1060

123.2 ± 0.5a

0.0390*

   

TC

217

126.2 ± 1.1b

 
   

TT

5

119.2 ± 7.4ab

 

M4

VIP

G51389822T

GG

74

123.6 ± 1.9

0.3271

   

GT

400

124.4 ± 0.8

 
   

TT

732

122.8 ± 0.6

 

M5

VIPR-1

A1661691G

GG

1028

123.9 ± 0.5a

0.0390*

   

GA

95

121.4 ± 1.7ab

 
   

AA

83

119.7 ± 1.8b

 

M6

VIPR-1

C1704887T

CC

1128

123.2 ± 0.5

0.2022

   

TC

72

125.7 ± 2.0

 
   

TT

6

132.0 ± 6.7

 

M7

VIPR-1

C1715301T

CC

842

123.9 ± 0.6

0.2648

   

TC

252

122.1 ± 1.0

 
   

TT

112

122.6 ± 1.6

 

M8

PRL

I59724210D

II

10

126.2 ± 5.2

0.1851

   

ID

187

121.4 ± 1.2

 
   

DD

1009

123.7 ± 0.5

 

1The sites were referred to the chicken genome sequences released in May, 2006 http://genome.ucsc.edu/cgi-bin/hgGateway;

2N indicated the number of tested chickens of each genotype;

3AFE = age at first egg, the values are least-square means ± standard errors (SE).

a,bWithin a column, for each site, measurements with no common superscripts are significantly different in single marker analysis, but not significantly different after Bonferroni correction (0.0042 < P < 0.05);

A,BWithin a column, for each site, measurements with no common superscripts are great significantly different (P < 0.00083); * and ** indicate 0.0042 < P < 0.05 and P < 0.00083, respectively.

Haplotype Structure in the VIPR-1 Gene and Their Association with AFE

M5, M6 and M7 were all in the chicken VIPR-1 gene and haplotype structure analysis showed that there was a haplotype block composed of M6 and M7. Three haplotypes with frequencies higher than 1%, H1 (CT, 18.91%), H2 (CC, 77.69%), and H3 (TC, 3.04%), were observed in this block. A total of 1, 295 NDH chickens with 6 diplotypes, including 114 of H1H1, 249 of H1H2, 14 of H1H3, 853 of H2H2, 60 of H2H3, and 5 of H3H3, were used in the association analysis. However, no significant association (P = 0.3133) was detected between the haplotypes and chicken AFE.

Association of AFE with Polymorphisms in the QTL Region of Interest in Chromosome Z

There were differences between the allelic frequency of T32742394C in the early and late AFE groups and differences in AFE between individuals with different alleles of C33379782T, although these differences were not significant (Table 4). T32742394C and C33379782T, which might be associated with AFE, were chosen for the following association analysis. In addition, sites T32742468C and G32742603A were selected as the controls.
Table 4

Allelic frequency in early and late AFE groups

Location1

Allele

Early2

Late2

Chi square

P value

32173403

A

20 (0.883)

22 (0.917)

0.762

0.3827

 

T

4 (0.167)

2 (0.083)

  

32742394

C

14 (0.583)

8 (0.333)

3.020

0.0822

 

T

10 (0.417)

16 (0.667)

  

32742468

C

6 (0.250)

8 (0.333)

0.400

0.5271

 

T

18 (0.750)

16 (0.667)

  

32742603

G

17 (0.708)

16 (0.667)

0.100

0.7518

 

A

7 (0.292)

8 (0.333)

  

33379782

C

1 (0.042)

5 (0.208)

3.048

0.0809

 

T

23 (0.958)

19 (0.792)

  

33610060

G

12 (0.500)

11 (0.458)

0.083

0.7733

 

A

12 (0.500)

13 (0.542)

  

33729521

(ATT)7

24 (1.000)

21 (0.875)

3.200

0.0736

 

(ATT)5

0 (0.000)

3 (0.125)

  

33832610

C

1 (0.042)

0 (0.000)

1.021

0.3123

 

T

23 (0.958)

24 (1.000)

  

33962646

T

7 (0.292)

5 (0.208)

0.444

0.5052

 

G

17 (0.708)

19 (0.792)

  

34050133

C

24 (1.000)

22 (0.917)

2.087

0.1486

 

T

0 (0.000)

2 (0.083)

  

34163373

C

4 (0.167)

3 (0.125)

0.167

0.6828

 

T

20 (0.833)

21 (0.875)

  

34263878

A

12 (0.500)

13 (0.542)

0.083

0.7733

 

G

12 (0.500)

11 (0.458)

  

1Location indicated the location on the Z chromosome;

2Number of chickens for each tail, number in brackets indicated the allelic frequency of each tail in the two-tail samples. A P-value < 0.0042 was considered significant.

Based on the results of the 2-tailed χ2 test, SNPs T32742394C, T32742468C, G32742603A, and C33379782T were chosen for marker-trait association analysis in 1, 310 NDH individuals. As summarized in Table 5, T32742394C was significantly associated (P < 0.05) with chicken AFE, and birds with the C genotype had earlier AFE than those with the T genotype. However, these significant effects disappeared after Bonferroni correction. No significant association with AFE was found for the other SNPs.
Table 5

Association of the 4 SNPs in the candidate QTL region with chicken AFE

No.

Location1

Genotype

N2

AFE3

P value

M10

T32742394C

C

415

122.2 ± 0.8a

0.0165*

  

T

797

124.5 ± 0.6b

 

M11

T32742468C

C

443

124.2 ± 0.8

0.4324

  

T

769

123.5 ± 0.6

 

M12

G32742603A

A

400

124.4 ± 0.8

0.3422

  

G

812

123.4 ± 0.6

 

M13

C33379782T

C

102

125.5 ± 1.6

0.2568

  

T

1110

123.6 ± 0.5

 

1The sites were referred to the location on the Z chromosome of the chicken genome sequences released in May, 2006 http://genome.ucsc.edu/cgi-bin/hgGateway;

2N indicated the number of tested chickens of each genotype;

3AFE = age at first egg, the values are least-square means ± standard errors (SE).

a,bWithin a column, for each site, measurements with no common superscripts are significantly different in single marker analysis, but not significantly different after Bonferroni correction (0.0042 < P < 0.05); *indicate 0.0042 < P < 0.05.

Haplotype Structure within the 4 SNPs and Their Association with AFE

A haplotype block of T32742394C and T32742468C was observed in the NDH population for the 4 SNPs in the QTL region of chromosome Z. Four haplotypes with frequencies higher than 1%, H1 (TC, 33.48%), H2 (TT, 29.84%), H3 (CC, 2.01%), and H4 (CT, 34.67%), were found in this block. A total of 1, 296 chickens with 7 diplotypes, including 432 of H1H1, 1 of H1H2, 1 of H1H4, 385 of H2H2, 1 of H2H4, 26 of H3H3, and 450 of H4H4, were used in association analysis and significant association (P < 0.05) of the haplotypes with AFE was observed (Table 6). Among the 7 diplotypes, H1H4 had a significantly later (P < 0.05) mean value of AFE (158.0 d) compared to the other diplotypes, except H1H2. Furthermore, H4H4 had a much earlier mean value of AFE (122.2 d) and was significantly different (P < 0.05) from that of H2H2.
Table 6

Association of the haplotypes in the QTL region with AFE

Trait1

P value

H1H12 (432)

H1H22 (1)

H1H42 (1)

H2H22 (385)

H2H42 (1)

H3H32 (26)

H4H42 (450)

AFE

0.0289*

124.2 ± 0.8bc

154.0 ± 16.5abc

158.0 ± 16.6a

124.7 ± 0.8b

111.0 ± 16.5bc

122.2 ± 3.2bc

122.2 ± 0.8c

1AFE = age at first egg;

2The values are least-square means ± standard errors (SE), number in brackets indicated the number of tested chickens of each diplotype;

a,b,cWithin a row with no common superscripts are significantly different (P < 0.05); *indicate P < 0.05.

Bioinformatics Analyses

The roles of most of the 22 functional genes within the QTL region are not known. Based on database Ensembl http://www.ensembl.org/Gallus_gallus/index.html, T32742394C related to AFE is located in the intron region of the SH3-domain GRB2-like 2 (SH3GL2) gene. T32742468C, which formed the haplotype block with T32742394C and then affected the AFE value, is also located in intron 1 of the chicken SH3GL2 gene.

Discussion

Recently, there were many studies seeking correlations between markers of candidate genes and chicken AFE [3739]. Although a large number of statistically significant associations were found out as assessed by a single marker analysis model in those studies, few of them were still significant while proper correction was made to reduce the false discovery rate. In this study, GnRH-I, NPY, DRD2, VIP, VIPR-1 and PRL were selected to undertake association analysis in an NDH population and 3 significant effects (P < 0.05) on chicken AFE were observed in single analysis: for C31394761T of the NPY gene, T5841629C of the DRD2 gene, and A1661691G of the VIPR-1 gene. However, like most of previous studies, those 3 significant effects disappeared after Bonferroni correction for multiple testing. Bonferroni correction, adjusting the Type 1 error by the total number of tests, is a simple method to control the false discovery rate based on the assumption that all the tests are independent [40]. However, it is known that SNPs in close proximity are not independent [41]. Therefore, there may be some overcorrection to employ the Bonferroni adjusted significance thresholds for multiple testing in the present study. In mammalian and avian species, the important role of NPY on the sexual maturation process has been reported [4244]. Dunn [13] found that a 4-bp indel about 700 bases upstream of the NPY gene transcription start site had a significant dominant effect on broiler AFE, and heterozygous individuals had an earlier AFE. Although a different mutation site was analyzed in this study, the NPY gene was also proved to be important for chicken AFE. In an earlier study, no significant association was observed between any mutations in the coding region of the dopamine D1 receptor (DRD1) gene and AFE [45]. Therefore, another dopamine receptor, DRD2, was chosen as the candidate for AFE in this study and the results showed that it was related with this trait. Additionally, an investigation completed by our groups in a different NDH population demonstrated that A1661691G of the VIPR-1 gene was associated with AFE [46], which was also observed in the current study. In the present study, the most notable effect on AFE in candidate genes was for the GnRH-I gene. The association between G840327C of the GnRH-I gene and AFE was consistently significant even with Bonferroni correction for multiple testing. In human, GnRH-I were mainly expressed in the hypothalamus and various compartments of ovary [47]. Some recent studies of human have reported homozygous frameshift mutations in the GnRH-I gene might cause normosmic idiopathic hypogonadotropic hypogonadism in subjects displaying delayed puberty [48, 49]. In zebra finch, Ubuka and Bentley demonstrated that GnRH-I mRNA signal was significantly increased in sexually mature birds and the ovary mass was correlated with the brain GnRH-I mRNA level [50]. In the current study, we have also shown that a marker in the GnRH-1 gene is associated with AFE in NDH chickens.

In the present study, four variations among many sites in the candidate QTL region were chosen for the following association analysis through two-tailed χ2 test method. Subsequently, T32742394C of chromosome Z was found to be associated with AFE, although the significant effect disappeared after Bonferroni correction. Results of haplotype analysis also showed that it was related to AFE. In the same way, Sutter [51] proved that a single insulin-like growth factor 1 allele was the major determinant of small size in dogs and Xu [35] identified the polymorphism T+619C of the DRD2 gene associated with duration of chicken broodiness. Through bioinformatics analysis, T32742394C and T32742468C were found to be located in the intron region of the SH3GL2 gene. SH3GL2, also known as SH3P4 or endophilin I, is a gene encoding the 353 amino acids of a protein that belongs to the endophilin family. Earlier studies showed that SH3GL2 was correlated with the regulation of synaptic vesicle endocytosis in mammals [52, 53]. In avian, Hirayama reported that the endophilin family was involved in oocyte endocytosis and development [54]. Therefore, it seemed that the SH3GL2 gene is associated with AFE in NDH chickens and the haplotypes of T32742394C-T32742468C might play an important role in AFE. However, the genetic effects of the SH3GL2 gene on AFE require further study.

Conclusions

In conclusion, the main genetic effects of genes were analyzed in this study and the results demonstrated that the SNP G840327C of the GnRH-I gene and the haplotypes of T32742394C-T32742468C of the SH3GL2 gene were associated with the chicken AFE. These results can provide some insight into the genetics of chicken AFE.

Notes

Declarations

Acknowledgements and Funding

The current work was funded by projects under the Major State Basic Research Development Program China, project No. 2006CB102107 and the earmarked fund for Modern Agro-industry Technology Research System, project No. nycytx-42-G1-04. It was also supported by the National High Technology Research and Development Program of China (863 Program), project No. 2010AA10A102 and the Science and Technology Program of Jiangxi Education Department, project No. GJJ09383.

Authors’ Affiliations

(1)
Department of Animal Genetics, Breeding and Reproduction, College of Animal Science, South China Agricultural University
(2)
Institute of Animal Science, Guangdong Academy of Agricultural Sciences
(3)
Biotechnology Institute, Jiang Xi Education College

References

  1. Brody T, Eitan Y, Soller M, Nir I, Nitsan Z: Compensatory growth and sexual maturity in broiler females reared under severe food restriction from day of hatching. Br Poult Sci. 1980, 21: 437-446. 10.1080/00071668008416694.View ArticlePubMedGoogle Scholar
  2. Zelenka DJ, Cherry JA, Nir I, Siegel PB: Body weight and composition of Japanese quail (Coturnix coturnix japonica) at sexual maturity. Growth. 1984, 48: 16-28.PubMedGoogle Scholar
  3. Gous RM, Bradford GD, Johnson SA, Morris TR: Effect of age of release from light or food restriction on age at sexual maturity and egg production of laying pullets. Br Poult Sci. 2000, 41: 263-271. 10.1080/713654932.View ArticlePubMedGoogle Scholar
  4. Ciacciariello M, Gous RM: A comparison of the effects of feeding treatments and lighting on age at first egg and subsequent laying performance and carcase composition of broiler breeder hens. Br Poult Sci. 2005, 46: 246-254. 10.1080/00071660500066233.View ArticlePubMedGoogle Scholar
  5. Palmert MR, Boepple PA: Variation in the timing of puberty: clinical spectrum and genetic investigation. J Clin Endocrinol Metab. 2001, 86: 2364-2368. 10.1210/jc.86.6.2364.View ArticlePubMedGoogle Scholar
  6. Gajdos ZK, Henderson KD, Hirschhorn JN, Palmert MR: Genetic determinants of pubertal timing in the general population. Mol Cell Endocrinol. 2010, 324: 21-29. 10.1016/j.mce.2010.01.038.PubMed CentralView ArticlePubMedGoogle Scholar
  7. Chen CF, Tixier-Boichard M: Correlated responses to long-term selection for clutch length in dwarf brown-egg layers carrying or not carrying the naked neck gene. Poult Sci. 2003, 82: 709-720.View ArticlePubMedGoogle Scholar
  8. Hu YH, Poivey JP, Rouvier R, Liu SC, Tai C: Heritabilities and genetic correlations of laying performance in Muscovy ducks selected in Taiwan. Br Poult Sci. 2004, 45: 180-185. 10.1080/00071660410001715777.View ArticlePubMedGoogle Scholar
  9. Lwelamira J, Kifaro GC, Gwakisa PS: Genetic parameters for body weights, egg traits and antibody response against Newcastle Disease Virus (NDV) vaccine among two Tanzania chicken ecotypes. Trop Anim Health Prod. 2009, 41: 51-59. 10.1007/s11250-008-9153-2.View ArticlePubMedGoogle Scholar
  10. Huhtaniemi I: Mutations along the pituitary-gonadal axis affecting sexual maturation: novel information from transgenic and knockout mice. Mol Cell Endocrinol. 2006, 254-255: 84-90. 10.1016/j.mce.2006.04.015.View ArticlePubMedGoogle Scholar
  11. Parent AS, Matagne V, Westphal M, Heger S, Ojeda S, Jung H: Gene expression profiling of hypothalamic hamartomas: a search for genes associated with central precocious puberty. Horm Res. 2008, 69: 114-123. 10.1159/000111815.View ArticlePubMedGoogle Scholar
  12. Feng T, Zhao YZ, Chu MX, Zhang YJ, Fang L, Di R, Cao GL, Li N: Association between sexual precocity and alleles of KISS-1 and GPR54 genes in goats. Anim Biotechnol. 2009, 20: 172-176. 10.1080/10495390903004493.View ArticlePubMedGoogle Scholar
  13. Dunn IC, Miao YW, Morris A, Romanov MN, Wilson PW, Waddington D: A study of association between genetic markers in candidate genes and reproductive traits in one generation of a commercial broiler breeder hen population. Heredity. 2004, 92: 128-134. 10.1038/sj.hdy.6800396.View ArticlePubMedGoogle Scholar
  14. Pau KY, Spies HG: Neuroendocrine signals in the regulation of gonadotropin-releasing hormone secretion. Chin J Physiol. 1997, 40: 181-196.PubMedGoogle Scholar
  15. Proudman JA, Scanes CG, Johannsen SA, Berghman LR, Camp MJ: Comparison of the ability of the three endogenous GnRHs to stimulate release of follicle-stimulating hormone and luteinizing hormone in chickens. Domest Anim Endocrinol. 2006, 31: 141-153. 10.1016/j.domaniend.2005.10.002.View ArticlePubMedGoogle Scholar
  16. Onagbesan OM, Metayer S, Tona K, Williams J, Decuypere E, Bruggeman V: Effects of genotype and feed allowance on plasma luteinizing hormones, follicle-stimulating hormones, progesterone, estradiol levels, follicle differentiation, and egg production rates of broiler breeder hens. Poult Sci. 2006, 85: 1245-1258.View ArticlePubMedGoogle Scholar
  17. Klenke U, Constantin S, Wray S: Neuropeptide Y directly inhibits neuronal activity in a subpopulation of gonadotropin-releasing hormone-1 neurons via Y1 receptors. Endocrinology. 2010, 151: 2736-2746. 10.1210/en.2009-1198.PubMed CentralView ArticlePubMedGoogle Scholar
  18. Fraley GS, Kuenzel WJ: Precocious puberty in chicks (Gallus domesticus) induced by central injections of neuropeptide Y. Life Sci. 1993, 52: 1649-1656. 10.1016/0024-3205(93)90047-7.View ArticlePubMedGoogle Scholar
  19. Davison BA, Kuenzel WJ: Hypothalamic biogenic amine levels in broiler chicks showing advanced sexual maturation. Poult Sci. 1991, 70: 1610-1618.View ArticlePubMedGoogle Scholar
  20. Al-Zailaie KA, Kang SW, Youngren OM, Thayananuphat A, Bakken T, Chaiseha Y, Millam JR, Proudman JA, El Halawani ME: Identification of dopamine, gonadotrophin-releasing hormone-I, and vasoactive intestinal peptide neurones activated by electrical stimulation to the medial preoptic area of the turkey hypothalamus: a potential reproductive neuroendocrine circuit. J Neuroendocrinol. 2006, 18: 514-525. 10.1111/j.1365-2826.2006.01443.x.View ArticlePubMedGoogle Scholar
  21. Thayananuphat A, Kang SW, Bakken T, Millam JR, El Halawani ME: Rhythmic dependent light induction of gonadotrophin-releasing hormone-I expression and activation of dopaminergic neurones within the premammillary nucleus of the turkey hypothalamus. J Neuroendocrinol. 2007, 19: 399-406. 10.1111/j.1365-2826.2007.01545.x.View ArticlePubMedGoogle Scholar
  22. Kadarmideen HN: Genetical systems biology in livestock: application to gonadotrophin releasing hormone and reproduction. IET Syst Biol. 2008, 2: 423-441. 10.1049/iet-syb:20070072.View ArticlePubMedGoogle Scholar
  23. el Halawani ME, Silsby JL, Youngren OM, Phillips RE: Exogenous prolactin delays photo-induced sexual maturity and suppresses ovariectomy-induced luteinizing hormone secretion in the turkey (Meleagris gallopavo). Biol Reprod. 1991, 44: 420-424. 10.1095/biolreprod44.3.420.View ArticlePubMedGoogle Scholar
  24. Rozenboim I, Tabibzadeh C, Silsby JL, el Halawani ME: Effect of ovine prolactin administration on hypothalamic vasoactive intestinal peptide (VIP), gonadotropin releasing hormone I and II content, and anterior pituitary VIP receptors in laying turkey hens. Biol Reprod. 1993, 48: 1246-1250. 10.1095/biolreprod48.6.1246.View ArticlePubMedGoogle Scholar
  25. Christian CA, Moenter SM: Vasoactive intestinal polypeptide can excite gonadotropin-releasing hormone neurons in a manner dependent on estradiol and gated by time of day. Endocrinology. 2008, 149: 3130-3136. 10.1210/en.2007-1098.PubMed CentralView ArticlePubMedGoogle Scholar
  26. Li H, Kuenzel WJ: A possible neural cascade involving the photoneuroendocrine system (PNES) responsible for regulating gonadal development in an avian species, Gallus gallus. Brain Res Bull. 2008, 76: 586-596. 10.1016/j.brainresbull.2008.04.007.View ArticlePubMedGoogle Scholar
  27. Schütz K, Kerje S, Carlborg O, Jacobsson L, Andersson L, Jensen P: QTL analysis of a red junglefowl × White Leghorn intercross reveals trade-off in resource allocation between behavior and production traits. Behav Genet. 2002, 32: 423-433.View ArticlePubMedGoogle Scholar
  28. Tuiskula-Haavisto M, Honkatukia M, Vilkki J, de Koning DJ, Schulman NF, Mäki-Tanila A: Mapping of quantitative trait loci affecting quality and production traits in egg layers. Poult Sci. 2002, 81: 919-927.View ArticlePubMedGoogle Scholar
  29. Sasaki O, Odawara S, Takahashi H, Nirasawa K, Oyamada Y, Yamamoto R, Ishii K, Nagamine Y, Takeda H, Kobayashi E, Furukawa T: Genetic mapping of quantitative trait loci affecting body weight, egg character and egg production in F2 intercross chickens. Anim Genet. 2004, 35: 188-194. 10.1111/j.1365-2052.2004.01133.x.View ArticlePubMedGoogle Scholar
  30. Schmid M, Nanda I, Hoehn H, Schartl M, Haaf T, Buerstedde JM, Arakawa H, Caldwell RB, Weigend S, Burt DW, Smith J, Griffin DK, Masabanda JS, Groenen MA, Crooijmans RP, Vignal A, Fillon V, Morisson M, Pitel F, Vignoles M, Garrigues A, Gellin J, Rodionov AV, Galkina SA, Lukina NA, Ben-Ari G, Blum S, Hillel J, Twito T, Lavi U, David L, Feldman MW, Delany ME, Conley CA, Fowler VM, Hedges SB, Godbout R, Katyal S, Smith C, Hudson Q, Sinclair A, Mizuno S: Second report on chicken genes and chromosomes 2005. Cytogenet Genome Res. 2005, 109: 415-479. 10.1159/000084205.View ArticlePubMedGoogle Scholar
  31. Wang J, He X, Ruan J, Dai M, Chen J, Zhang Y, Hu Y, Ye C, Li S, Cong L, Fang L, Liu B, Li S, Wang J, Burt DW, Wong GK, Yu J, Yang H, Wang J: ChickVD: a sequence variation database for the chicken genome. Nucleic Acids Res. 2005, 33: D438-441. 10.1093/nar/gki092.PubMed CentralView ArticlePubMedGoogle Scholar
  32. Hu ZL, Fritz ER, Reecy JM: AnimalQTLdb: a livestock QTL database tool set for positional QTL information mining and beyond. Nucleic Acids Res. 2007, 35: D604-609. 10.1093/nar/gkl946.PubMed CentralView ArticlePubMedGoogle Scholar
  33. Cui JX, Du HL, Liang Y, Deng XM, Li N, Zhang XQ: Association of polymorphisms in the promoter region of chicken prolactin with egg production. Poult Sci. 2006, 85: 26-31.View ArticlePubMedGoogle Scholar
  34. Zhou M, Lei M, Rao Y, Nie Q, Zeng H, Xia M, Liang F, Zhang D, Zhang X: Polymorphisms of vasoactive intestinal peptide receptor-1 gene and their genetic effects on broodiness in chickens. Poult Sci. 2008, 87: 893-903. 10.3382/ps.2007-00495.View ArticlePubMedGoogle Scholar
  35. Xu HP, Shen X, Zhou M, Luo CL, Kang L, Liang Y, Zeng H, Nie QH, Zhang DX, Zhang XQ: The dopamine D2 receptor gene polymorphisms associated with chicken broodiness. Poult Sci. 2010, 89: 428-438. 10.3382/ps.2009-00428.View ArticlePubMedGoogle Scholar
  36. Zhou M, Du Y, Nie Q, Liang Y, Luo C, Zeng H, Zhang X: Associations between polymorphisms in the chicken VIP gene, egg production and broody traits. Br Poult Sci. 2010, 51: 195-203. 10.1080/00071661003745786.View ArticlePubMedGoogle Scholar
  37. Feng XP, Kuhnlein U, Aggrey SE, Gavora JS, Zadworny D: Trait association of genetic markers in the growth hormone and the growth hormone receptor gene in a White Leghorn strain. Poult Sci. 1997, 76: 1770-1775.View ArticlePubMedGoogle Scholar
  38. Ou JT, Tang SQ, Sun DX, Zhang Y: Polymorphisms of three neuroendocrine-correlated genes associated with growth and reproductive traits in the chicken. Poult Sci. 2009, 88: 722-727. 10.3382/ps.2008-00497.View ArticlePubMedGoogle Scholar
  39. Liu WJ, Sun DX, Yu Y, Li G, Tang SQ, Zhang Y, Wang YC, Zhang Y: Association of Janus kinase 2 polymorphisms with growth and reproduction traits in chickens. Poult Sci. 2010, 89: 2573-2579. 10.3382/ps.2010-00988.View ArticlePubMedGoogle Scholar
  40. Duggal P, Gillanders EM, Holmes TN, Bailey-Wilson JE: Establishing an adjusted p-value threshold to control the family-wide type 1 error in genome wide association studies. BMC Genomics. 2008, 9: 516-10.1186/1471-2164-9-516.PubMed CentralView ArticlePubMedGoogle Scholar
  41. Nicodemus KK, Liu W, Chase GA, Tsai YY, Fallin MD: Comparison of type I error for multiple test corrections in large single-nucleotide polymorphism studies using principal components versus haplotype blocking algorithms. BMC Genet. 2005, 6 (Suppl 1): S78-10.1186/1471-2156-6-S1-S78.PubMed CentralView ArticlePubMedGoogle Scholar
  42. Gruaz NM, Pierroz DD, Rohner-Jeanrenaud F, Sizonenko PC, Aubert ML: Evidence that neuropeptide Y could represent a neuroendocrine inhibitor of sexual maturation in unfavorable metabolic conditions in the rat. Endocrinology. 1993, 133: 1891-1894. 10.1210/en.133.4.1891.PubMedGoogle Scholar
  43. Kuenzel WJ, Fraley GS: Neuropeptide Y: its role in the neural regulation of reproductive function and food intake in avian and mammalian species. Poult Avian Biol Rev. 1995, 6: 185-209.Google Scholar
  44. Walsh KM, Kuenzel WJ: Effect of sulfamethazine on sexual precocity and neuropeptide Y neurons within the tuberoinfundibular region of the chick brain. Brain Res Bull. 1997, 44: 707-713. 10.1016/S0361-9230(97)00268-2.View ArticlePubMedGoogle Scholar
  45. Xu H, Shen X, Zhou M, Fang M, Zeng H, Nie Q, Zhang X: The genetic effects of the dopamine D1 receptor gene on chicken egg production and broodiness traits. BMC Genet. 2010, 11: 17-10.1186/1471-2156-11-17.PubMed CentralView ArticlePubMedGoogle Scholar
  46. Zhou M, Liang F, Rao Y, Zeng H, Zhang D, Zhang X: Association of twelve polymorphisms of the VIPR-1 gene with chicken early egg production traits. Chinese Journal of Animal and Veterinary Sciences. 2008, 39: 1147-1152.Google Scholar
  47. Metallinou C, Asimakopoulos B, Schröer A, Nikolettos N: Gonadotropin-releasing hormone in the ovary. Reprod Sci. 2007, 14: 737-749. 10.1177/1933719107310707.View ArticlePubMedGoogle Scholar
  48. Chan YM, de Guillebon A, Lang-Muritano M, Plummer L, Cerrato F, Tsiaras S, Gaspert A, Lavoie HB, Wu CH, Crowley WF, Amory JK, Pitteloud N, Seminara SB: GNRH1 mutations in patients with idiopathic hypogonadotropic hypogonadism. Proc Natl Acad Sci USA. 2009, 106: 11703-11708. 10.1073/pnas.0903449106.PubMed CentralView ArticlePubMedGoogle Scholar
  49. Silveira LF, Trarbach EB, Latronico AC: Genetics basis for GnRH-dependent pubertal disorders in humans. Mol Cell Endocrinol. 2010, 324: 30-38. 10.1016/j.mce.2010.02.023.View ArticlePubMedGoogle Scholar
  50. Ubuka T, Bentley GE: Identification, localization, and regulation of passerine GnRH-I messenger RNA. J Endocrinol. 2009, 201: 81-87. 10.1677/JOE-08-0508.View ArticlePubMedGoogle Scholar
  51. Sutter NB, Bustamante CD, Chase K, Gray MM, Zhao K, Zhu L, Padhukasahasram B, Karlins E, Davis S, Jones PG, Quignon P, Johnson GS, Parker HG, Fretwell N, Mosher DS, Lawler DF, Satyaraj E, Nordborg M, Lark KG, Wayne RK, Ostrander EA: A single IGF1 allele is a major determinant of small size in dogs. Science. 2007, 316: 112-115. 10.1126/science.1137045.PubMed CentralView ArticlePubMedGoogle Scholar
  52. Reutens AT, Begley CG: Endophilin-1: a multifunctional protein. Int J Biochem Cell Biol. 2002, 34: 1173-1177. 10.1016/S1357-2725(02)00063-8.View ArticlePubMedGoogle Scholar
  53. Anggono V, Robinson PJ: Syndapin I and endophilin I bind overlapping proline-rich regions of dynamin I: role in synaptic vesicle endocytosis. J Neurochem. 2007, 102: 931-943. 10.1111/j.1471-4159.2007.04574.x.View ArticlePubMedGoogle Scholar
  54. Hirayama S, Bajari TM, Nimpf J, Schneider WJ: Receptor-mediated chicken oocyte growth: differential expression of endophilin isoforms in developing follicles. Biol Reprod. 2003, 68: 1850-1860. 10.1095/biolreprod.102.012427.View ArticlePubMedGoogle Scholar

Copyright

© Xu et al; licensee BioMed Central Ltd. 2011

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement