Major genomic mitochondrial lineages delineate early human expansions

  • Nicole Maca-Meyer1,

    Affiliated with

    • Ana M González1,

      Affiliated with

      • José M Larruga1,

        Affiliated with

        • Carlos Flores1 and

          Affiliated with

          • Vicente M Cabrera1Email author

            Affiliated with

            BMC Genetics20012:13

            DOI: 10.1186/1471-2156-2-13

            Received: 9 July 2001

            Accepted: 13 August 2001

            Published: 13 August 2001

            Abstract

            Background

            The phylogeographic distribution of human mitochondrial DNA variations allows a genetic approach to the study of modern Homo sapiens dispersals throughout the world from a female perspective. As a new contribution to this study we have phylogenetically analysed complete mitochondrial DNA(mtDNA) sequences from 42 human lineages, representing major clades with known geographic assignation.

            Results

            We show the relative relationships among the 42 lineages and present more accurate temporal calibrations than have been previously possible to give new perspectives as how modern humans spread in the Old World.

            Conclusions

            The first detectable expansion occurred around 59,000–69,000 years ago from Africa, independently colonizing western Asia and India and, following this southern route, swiftly reaching east Asia. Within Africa, this expansion did not replace but mixed with older lineages detectable today only in Africa. Around 39,000–52,000 years ago, the western Asian branch spread radially, bringing Caucasians to North Africa and Europe, also reaching India, and expanding to north and east Asia. More recent migrations have entangled but not completely erased these primitive footprints of modern human expansions.

            Background

            Human mtDNA is a non-recombining molecule with maternal inheritance and practically haploid genetics. Differences between mtDNA sequences are only due to mutation. As time passes, mutations accumulate sequentially along less and less related molecules that constitute independent lineages known as haplotypes. Relationships among lineages can be estimated by phylogenetic networks [1] where mutations are classified in hierarchical levels. Basal mutations are shared for clusters of lineages, defined as haplogroups, whereas those at the tips characterize individuals. Major haplogroups [2] are continental or ethnically specific. Three of them (L1, L2, and L3) group sub-Saharan African lineages, nine (H, I, J, K, T, U, V, W and X) encompass almost all mtDNAs from European, North African and Western Asian Caucasians. Finally, haplogroups A, B, C, D, E, F, G and M embrace the majority of the lineages described for Asia, Oceania and native Americans. The geographic distribution of derived branches of these haplogroups has shed light on crucial aspects of human history, such as the probable origin and approximate dating of migrations into the New World [3] and Polynesia [4, 5], and quantitative estimations of the relative Paleolithic and Neolithic contributions to the extant European mtDNA diversity [2]. At the other end of the phylogenetic tree, the ultimate coalescence of all worldwide mtDNA lineages into Africa has favored, since the beginning, the recent African origin hypothesis for all modern humans [6]. The analyses of the complete mtDNA sequence of 53 humans of diverse origins [7] have added statistical support to this hypothesis. However, as the current definition of the major haplogroups is not based on total genomic sequences, there is not yet a clear resolution of their basal relationships. This genomic phylogenetic reconstruction is necessary to infer the early human dispersal routes after the African exodus. We present the phylogenetic network of 42 complete mtDNA sequences including representatives of the major haplogroups. Based on their relative clustering and coalescence ages we propose a tentative model of the way the Old World could have been colonized by modern humans.

            Results and Discussion

            The phylogenetic network of the 42 mtDNA sequences (Fig. 1) was free of reticulations when mutations [8] 150, 152, 303i and 16519 were omitted in its construction. The tree topology was the same as the bootstrap supporting neighbor joining tree. We detected 35 parallel substitutions from 124 variable positions (28%) in the non-coding region (1,122 bp in length), and 45 from 409 (11%) in the coding region (15,447 bp in length). Shared mutations in basal branches of the tree relate haplogroups, however, parallel mutations should be avoided in their global affiliations. As can be expected from haplotypes of well-differentiated haplogroups the majority of mutations are in the external branches of the tree, including those that specifically define them [2]. Nevertheless, it is well known that in population studies these main lineages sprout into several sub-clusters sometimes with interesting geographic localization. In the cases where representatives of these sub-clusters have also been analyzed, it is evident that the African ones are at the same level of divergence as non-African clusters. More information of cluster structure in Africa is necessary. In non African groups, two haplotypes belonging to sub-haplogroup U2 have a divergence similar to that found between other sub-clusters of the Caucasian U haplogroup. One of them, lacking mutations 16129C and 15907, that are present in all western Eurasian representatives, resembles haplotypes found in India [9]. The proposed inclusion of haplogroup K into the U cluster [10] is confirmed, being U7 its most probable related sub-clade. Main Asian haplogroups belong to two different major clusters, whereas A and B rooted with Caucasoid haplogroups, C, D, G and M constitute a monophyletic cluster. Likewise, African haplogroup L3 is more related to Eurasian haplogroups than to the most divergent African clusters L1 and L2. Chimpanzee rooting shows that the oldest lineage of extant modern humans is the African L1a cluster. In addition, the significant bootstrap values on the deep African branches reinforce the statistical support that the out of Africa hypothesis has obtained through a parallel genomic mtDNA study [7]. We have estimated a minimum total coalescence for modern human lineages from 156,000 to 169,000 years before present (yr BP). The two subsequent ancient splits also happened inside Africa, originating the L1b/c and L2 haplogroups with ages of 122,000–132,000 yr BP and 85,000–95,000 yr BP respectively. These three clades still have an overwhelming sub-Saharan African implantation. The next branching (Fig. 2), dated between 59,000–69,000 yr BP, also occurred in Africa but comprising clades currently found only in this continent (L3), and others with a first expansion out of Africa. Today, L3 derivatives are present in nearly all the African populations. This ancient spread inside Africa has been directly detected by the ages of several sub-clade expansions [11] and indirectly confirmed by genetic admixture, involving archaic and modern autosomal gene alleles, detected only in Africa [12]. The coexistence in African populations of very divergent non-recombining lineages may erroneously bias demographic estimations based on pair-wise nucleotide differences [11]. Two hypothetical routes for the Asian colonization have been proposed [13], one through Central Asia and one through South Asia. Coincidentally, we detect at least two independent lineages spreading out of Africa. One comprises all M derivatives that radiated 30,000–57,600 yr BP. Subsequent expansions of this clade have been found in India [9] and Eastern Asia where it possibly originated and expanded as haplogroups C, D, G and others [14]. The star-like radiation of these clades suggests that this wide geographic colonization could have happened in a relatively short time. Genetic support for this southern spread of M through Ethiopia and the Arabian Peninsula along South Asia has been recently proposed due to the presence of subclade M1 in Eastern Africa [15]. However, a posterior return from Asia to Africa of these lineages is a more plausible explanation because the genetic diversity of M is much greater in India [9] than in Ethiopia [15]. In fact, M1 could be a branch of the Indian cluster M as ancestral motifs of the African M1 are found in M*, M3 and M4 Indian subclusters [16]. Furthermore, one of the most derived M3 haplotypes in India (10398, 10400, 16086, 16129, 16223, 16249, 16259, 16311) has all the basic substitutions that defined the Ethiopian clade, excepting the highly variable 16189 [9]. This supposed Indian expansion to the west also reached northern areas since evolved representatives of M4 have been also detected in Central Asia [17]. We may consider the upper bound for this return to Africa 25,000–47,000 yr BP, the age calculated for M1 in Eastern Africa based on HVSI sequences or 33,000–63,000 obtained using RFLPs [15].
            http://static-content.springer.com/image/art%3A10.1186%2F1471-2156-2-13/MediaObjects/12863_2001_Article_17_Fig1_HTML.jpg
            Figure 1

            Phylogenetic network based on complete mtDNA genome sequences. Nomenclature of individuals is as in Table 1. Numbers along the links refer to nucleotide positions; suffixes are transversions; underlining indicates recurrent mutations; the order of the mutations on a path not interrupted by any branching or distinguished nodes is arbitrary. The same topology was supported by bootstraps, using NJ and 1000 replicates; the bootstrap values higher than 50% are shown over the branches. The star shows the position where the chimpanzee sequence roots in the network.

            http://static-content.springer.com/image/art%3A10.1186%2F1471-2156-2-13/MediaObjects/12863_2001_Article_17_Fig2_HTML.jpg
            Figure 2

            Geographic dispersal routes and minimal estimated ages of major human expansions in the Old World, deduced from the age and geographic localisation of main mtDNA haplogroups.

            Table 1

            HVS I motifs

            Sample

            HVS I motif

            Haplogroup

            Origin

            Ref.a

            K

            145 224 311

            K

            Iberian

            1

            U7

            248 318T

            U7

            Iberian

            1

            U31

            343 356 390

            U3

            Canarian

            1

            U32

            343 390

            U3

            Moroccan

            1

            U21

            051 092 129C 189 362 368

            U2

            Jordanian

            1

            U22

            051 129C 189 319 362

            U2

            Iberian

            1

            U2

            051 189 234 294

            U2

            Jordanian

            1

            U5b

            189 192 270

            U5b

            Berber

            1

            U5a

            093 153 256 270 311 399

            U5a1a

            Swede

            2

            U6

            172 219

            U6

            Moroccan

            1

            H1

             

            H

            Mauritanian

            1

            HF

            093 183d 189

            H

             

            3

            RCRS

             

            H

            European

            4

            H2

             

            H

            Iberian

            1

            V

            298

            V

            Berber

            1

            HV

            278 311

            HV

            Jordanian

            1

            T5

            126 153 189 294

            T5

            Moroccan

            1

            T1

            126 163 186 189 294

            T1

            Iberian

            1

            J1b

            069 126 145 222 261

            J1b

            Moroccan

            1

            J2

            069 126 193 300

            J2

            Iberian

            1

            B

            136 183C 189 217 284

            B

            Japanese

            5

            I

            129 148 223 391

            I

            Iberian

            1

            IF

            129 184A 223 391

            I

             

            3

            N1b

            145 176G 180 223 390

            N1b

            Jordanian

            1

            W

            223 292

            W

            Iberian

            1

            X

            129 189 223 278

            X

            Moroccan

            1

            A

            111 209 223 290 319 362

            A

            Canarian

            1

            M11

            129 182C 183C 189 223 249 311

            M1

            Moroccan

            1

            M12

            185 189 223 249 311

            M1

            Jordanian

            1

            G

            189 194 195G 197G 223 256 278 362

            G

            Japanese

            6

            M3

            140 209 223 262 274 320 399

            M

            Japanese

            7

            D

            184iC 190iC 223 311 316 362

            D

            Japanese

            6

            M1

            223 295 362

            M

            Filipino

            1

            M2

            223

            M

            Indian

            1

            C

            223 298 325 327

            C

            Canarian

            1

            L3b

            124 223 278 362

            L3b

            Mauritanian

            1

            L3d

            124 223 256

            L3d

            Jordanian

            1

            L2

            223 278 390

            L2

            Mauritanian

            1

            L1c

            129 189 223 278 294 311 360

            L1c

            Mauritanian

            1

            L1b

            126 187 189 223 264 270 278 293 311

            L1b

            Mauritanian

            1

            L1a

            129 148 168 172 187 188G 189

               
             

            223 230 278 293 311 320

            L1a

            Moroccan

            1

            L1aA

            148 172 184 187 188A 189 223

               
             

            230 311 320

            L1a

            African

            8

            a 1, This work; 2, GenBank accession number X93334; 3, H and I references [34], we have added for the comparisons the 263, 311i and 16519 mutations in both sequences and 00073 in the I sequence; 4, revised Cambridge reference, GenBank accession number NC 001807; 5, Positive control [35], for comparisons we added 1438; 6, MELAS, P-1 (G) and FICM (D) [36]; 7, (ref [37]); 8, GenBank accession number D38112, for comparisons we added 311i.

            The other major branch that left Africa gave rise mainly to Caucasoid lineages which is congruent with a northern route through the Levant. With a lower bound of 43,000–53,000 yr BP this branch spread into at least three main clusters. One comprises haplogroups X and A with only a shared mutation between them and different geographic distributions. Whereas A is widespread in Asia, X is mainly restricted to Europe. Curiously, representatives of both clusters have been detected in native Americans raising the possibility that some American Indian could have European ancestry [18]. Nevertheless, X haplotypes have recently been detected in Central Asia. These Asian X haplotypes lack the 225A mutation, as the majority of the American X, pointing to this area as the most probable source for the dispersal of the New World founders [19]. The second cluster groups minor haplogroups W, I and N1b, the three are present although in low frequencies in Europe, Near East and Caucasus but only I and N1b have been also detected in Egypt and Arabia [2]. The last group radiated around 39,000–52,000 yr BP, giving at least four ancestral clusters. One of them originated haplogroup B that expanded to Eastern Asia, reaching Japan and southeastern Pacific Archipelagos [20, 21]. In early studies, this clade was defined by the 9-bp COII-tRNALys deletion but after that it has been found with independent origins on other haplogroup backgrounds [2224]. In this study we have detected this deletion on an Iberian haplotype belonging to haplogroup I. Curiously, it was also found in an Italian haplotype I [25]. However, the 9-bp deletion was absent in a wide screen that we carried out on Iberian and Northwest African I haplotypes. The detection in two Mediterranean populations of I haplotypes harboring the 9-bp deletion points to the existence in this area of a subset of I haplotypes that share a recent common ancestor. As happens with A, haplogroup B has not been found in northern India [9] but is present in Mongolia [26], favoring a Central Asian route for the expansion of these prominent Asian haplogroups. Two additional clades join haplogroups J and T and haplogroups H, V and HV respectively. Derivatives of at least some of them are found in Europe, North Africa, Central Asia and even India, but the most probable origin for all these expansions is the Near East-Caucasus area [2, 17, 27]. Finally, cluster U seems to have suffered a radial spread (Fig. 2), giving subsequent diversification in different geographic areas. Three sub-haplogroups, U2, U5 and U6 had their major expansions in India, Europe and North Africa respectively. U2 split in two branches, one, characterized by mutations 16129C and 15907, is geographically scattered from Western Europe to Mongolia [2, 26] but has not been detected in North Africa. The other reached India where it gave origin to several sub-clusters with global frequencies around 10% being, after its predecessor haplogroup M (53%), the second most abundant haplogroup in India [9]. U7 with a minor implantation in Europe but third in frequency in India [9] and also not detected in North Africa might have had a similar expansion as U2. The main radiation of haplogroup U5 occurred in Europe. It has been stated that this lineage entered Europe during the Upper Paleolithic [2], most probably from the Middle East-Caucasus area. The great divergence found here for the two U5 representatives is in agreement with the old age proposed for this haplogroup. Finally, U6 traces the first detectable Paleolithic return to Africa of ancient Caucasoid lineages. It has been mostly found in Northwest Africa, with a global estimated age of 47,000 years [28] reflecting an old human continuity in that rather isolated area. The fact that in Europe it has only been detected in the Iberian Peninsula [29] rules out a possible European route, unless a total lineage extinction in all the path is invoked. On the other hand, its presence in Northeast Africa [30], albeit in low frequencies, reinforces its way through North Africa. A third possibility could be that this lineage never went out of Africa but its coalescence with clades which all had prominent expansions in Eurasia weakens this option. U3 has also been found with a comparatively higher frequency in Northwest Africa [29] and might have followed the same route as U6, however, as its star-like expansion in the Caucasus has been dated around 30,000 yr BP [30], it most probably reached Africa in a posterior expansion. This out of Africa and back again hypothesis has also been suggested for Y-chromosome lineages [31]. Subsequent Neolithic and historic expansions have doubtlessly reshaped the human genetic pool in wide geographic areas but mainly as limited gene flow, not admixture, between populations. Consequently, the continental origin of the major haplogroups can still be detected and the earliest human routes inferred through them.

            Conclusions

            After coming out of Africa, modern humans first spread to Asia following two main routes. The southern one is represented by haplogroup M and related clades that are overwhelmingly present in India and eastern Asia. The northern one gave a posterior radiation that, through Central Asia, again reached North and East Asia carrying, among others, the prominent lineages A and B. Later expansions, can be detected by the presence of subclades of haplogroup U in India and Europe. There were also returns to Africa, most probably from the same two routes. The return from India could be detected by the presence of derivatives of M in Northeast Africa, and the arrival of Caucasoids by the existence of a subclade of haplogroup U that, today, is mainly confined to Northwest Africa.

            Materials and Methods

            Lineages

            We have manually sequenced 33 complete mtDNA genomes from available samples previously assigned to major haplogroups. To include lacking haplogroups we added 9 published sequences to the analyses (Table 1).

            Complete mtDNA sequences

            Complete mtDNA were amplified in 32 overlapping fragments with primers and PCR conditions described in Table 2. The same primers were utilized to directly sequence both strands of the fragments using the Promega fmol® DNA Cycle Sequencing System and the Usb Thermo Sequenase Radiolabelled Terminator Cycle Sequencing Kits.
            Table 2

            Oligonucleotide pairs used in the amplification and sequencing

            Name

            CRS reference

            Sequence (5'–3')

            Fragment size (pb)

            Annealing temp.(°C)

            L16340

            (16318–16340)

            AGCCATTTACCGTACATAGCACA

            681

            52

            H408

            (429–408)

            TGTTAAAAGTGCATACCGCCA

              

            L382

            (362–382)

            CAAAGAACCCTAACACCAGCC

            603

            56

            H945

            (964–945)

            GGGAGGGGGTGATCTAAAAC

              

            L923

            (902–923)

            GTCACACGATTAACCCAAGTCA

            607

            56

            H1487

            (1508–1487)

            GTATACTTGAGGAGGGTGACGG

              

            L1466

            (1445–1466)

            GAGTGCTTAGTTGAACAGGGCC

            629

            58

            H2053

            (2073–2053)

            TTAGAGGGTTCTGTGGGCAAA

              

            L2025

            (2004–2025)

            GCCTGGTGATAGCTGGTTGTCC

            609

            52

            H2591

            (2612–2591)

            GGAACAAGTGATTATGCTACCT

              

            L2559

            (2538–2559)

            CACCGCCTGCCCAGTGACACAT

            591

            56

            H3108

            (3128–3108)

            TCGTACAGGGAGGAATTTGAA

              

            L3073

            (3051–3073)

            AAAGTCCTACGTGATCTGAGTTC

            640

            52

            H3670

            (3690–3670)

            GGCGTAGTTTGAGTTTGATGC

              

            L3644

            (3625–3644)

            GCCACCTCTAGCCTAGCCGT

            623

            58

            H4227

            (4247–4227)

            ATGCTGGAGATTGTAATGGGT

              

            L4210

            (4189–4210)

            CCACTCACCCTAGCATTACTTA

            625

            55

            H4792

            (4813–4792)

            ACTCAGAAGTGAAAGGGGGCTA

              

            L4750

            (4729–4750)

            CCAATACTACCAATCAATACTC

            599

            52

            H5306

            (5327–5306)

            GGTGATGGTGGCTATGATGGTG

              

            L5278

            (5259–5278)

            TGGGCCATTATCGAAGAATT

            593

            58

            H5832

            (5851–5832)

            GACAGGGGTTAGGCCTCTTT

              

            L5781

            (5762–5781)

            AGCCCCGGCAGGTTTGAAGC

            626

            58

            H6367

            (6387–6367)

            TGGCCCCTAAGATAGAGGAGA

              

            L6337

            (6318–6337)

            CCTGGAGCCTCCGTAGACCT

            601

            58

            H6899

            (6918–6899)

            GCACTGCAGCAGATCATTTC

              

            L6869

            (6850–6869)

            CCGGCGTCAAAGTATTTAGC

            578

            58

            H7406

            (7427–7406)

            GGGTTCTTCGAATGTGTGGTAG

              

            L7379

            (7358–7379)

            AGAAGAACCCTCCATAAACCTG

            580

            56

            H7918

            (7937–7918)

            AGATTAGTCCGCCGTAGTCG

              

            L7882

            (7861–7882)

            TCCCTCCCTTACCATCAAATCA

            506

            56

            H8345

            (8366–8345)

            TTTCACTGTAAAGAGGTGTTGG

              

            L8299

            (8280–8299)

            ACCCCCTCTAGAGCCCACTG

            603

            56

            H8861

            (8882–8861)

            GAGCGAAAGCCTATAATCACTG

              

            L8799

            (8779–8799)

            CTCGGACTCCTGCCTCACTCA

            638

            58

            H9397

            (9416–9397)

            GTGGCCTTGGTATGTGCTTT

              

            L9362

            (9342–9362)

            GGCCTACTAACCAACACACTA

            609

            56

            H9928

            (9950–9928)

            AACCACATCTACAAAATGCCAGT

              

            L9886

            (9865–9886)

            TCCGCCAACTAATATTTCACTT

            617

            56

            H10462

            (10481–10462)

            AATGAGGGGCATTTGGTAAA

              

            L10403

            (10383–10403)

            AAAGGATTAGACTGAACCGAA

            612

            56

            H10975

            (10994–10975)

            CCATGATTGTGAGGGGTAGG

              

            L10949

            (10930–10949)

            CTCCGACCCCCTAACAACCC

            617

            58

            H11527

            (11546–11527

            CAAGGAAGGGGTAGGCTATG

              

            L11486

            (11467–11486

            AAAACTAGGCGGCTATGGTA

            629

            56

            H12076

            (12095–12076

            GGAGAATGGGGGATAGGTGT

              

            L12028

            (12008–12028

            GGCTCACTCACCCACCACATT

            615

            58

            H12603

            (12623–12603

            ACGAACAATGCTACAGGGATG

              

            L12572

            (12553–12572

            ACAACCCAGCTCTCCCTAAG

            591

            56

            H13124

            (13143–13124

            ATTTTCTGCTAGGGGGTGGA

              

            L13088

            (13068–13088

            AGCCCTACTCCACTCAAGCAC

            618

            58

            H13666

            (13685–13666

            AGGGTGGGGTTATTTTCGTT

              

            L13612

            (13593–13612

            AAGCGCCTATAGCACTCGAA

            614

            56

            H14186

            (14206–14186

            TGGTTGAACATTGTTTGTTGG

              

            L13612

            (13593–13612

            AAGCGCCTATAGCACTCGAA

            614

            56

            H14186

            (14206–14186

            TGGTTGAACATTGTTTGTTGG

              

            L14125

            (14104–14125

            TCTTTCTTCTTCCCACTCATCC

            602

            58

            H14685

            (14705–14685

            CATTGGTCGTGGTTGTAGTCC

              

            L14650

            (14629–14650

            CCCCATTACTAAACCCACACTC

            604

            58

            H15211

            (15232–15211

            TTGAACTAGGTCTGTCCCAATG

              

            L15162

            (15143–15162

            CTCCCGTGAGGCCAAATATC

            597

            58

            H15720

            (15739–15720

            GTCTGCGGCTAGGAGTCAAT

              

            L15676

            (15657–15676

            TCCCCATCCTCCATATATCC

            524

            56

            H16157

            (16180–16157

            TGATGTGGATTGGGTTTTTATGTA

              

            L15996

            (15975–15996

            CTCCACCATTAGCACCCAAAGC

            446

            58

            H16401

            (16420–16401

            TGATTTCACGGAGGATGGTG

              

            Statistic analyses

            Sequences were aligned manually. Phylogenetic relationships were estimated using median-joining networks [32] as implemented in Network 2.0d http://​www.​fluxus-engineering.​com and refined by hand. The same topology was obtained using the neighbor-joining method [33]. A chimpanzee sequence (GenBank accession n° D38113) was added to root the networks. Statistical significance of the branches were accomplished by bootstrap resampling with 1000 replications (PHYLIP Package 3.5c, http://​evolution.​genetics.​washington.​edu/​phylip.​html). Minimum estimates of coalescence ages, and 95% confidence intervals, were based on mean divergence among lineages for the coding region and a constant evolutionary rate of 1.7 × 10-8 per site per year that has been inferred for this region on the basis of 53 complete mtDNA sequences [7].

            Accesion numbers

            Sequences are available in GenBank (accession nos. AF381981-AF382013)

            Authors’ Affiliations

            (1)
            Department of Genetics, Faculty of Biolog, University of La Laguna

            References

            1. Bandelt H–J, Forster P, Sykes BC, Richards MB: Mitochondrial portraits of human populations using median networks. Genetics 1995, 141:743–753.PubMed
            2. Richards M, Macaulay V, Hickey E, Vega E, Sykes B, Guida V, Rengo Ch, Sellito D, Cruciani F, Kivisild T, et al.: Tracing European founder lineages in the Near Eastern mtDNA pool. Am. J. Hum. Genet. 2000, 67:1251–1276.PubMed
            3. Torroni A, Neel JV, Barrantes R, Schurr TG, Wallace DC: Mitochondrial DNA "clock" for the Amerinds and its implications for timing their entry into North America. Proc Natl Acad Sci U.S.A. 1994, 91:1158–1162.View ArticlePubMed
            4. Sykes B, Leiboff A, Low–Beer J, Tetzner S, Richards M: The origins of the Polynesians: An interpretation from mitochondrial lineage analysis. Am. J. Hum. Genet. 1995, 57:1463–1475.PubMed
            5. Lum JK, Cann RL, Martinson JJ, Jorde LB: Mitochondrial and nuclear genetic relationships among Pacific Island and Asian populations. Am. J. Hum. Genet. 1998, 63:613–624.View ArticlePubMed
            6. Cann RL, Stoneking M, Wilson AC: Mitochondrial DNA and human evolution. Nature 1987, 325:31–36.View ArticlePubMed
            7. Ingman M, Kaessmann H, Pääbo S, Gyllensten U: Mitochondrial genome variation and the origin of modern humans. Nature 2000, 408:708–713.View ArticlePubMed
            8. Anderson S, Bankier AT, Barrell BG, de Bruijn MHL, Coulson AR, Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F, et al.: Sequence and organization of the human mitochondrial genome. Nature 1981, 290:457–465.View ArticlePubMed
            9. Kivisild T, Bamshad MJ, Kaldma K, Metspalu M, Metspalu E, Reidla M, Laos S, Parik J, Watkins WS, Dixon ME, et al.: Deep common ancestry of Indian and western–Eurasian mitochondrial DNA lineages. Curr. Biol. 1999, 9:1331–1334.View ArticlePubMed
            10. Macaulay V, Richards M, Hickey E, Vega E, Cruciani F, Guida V, Scozzari R, Bonné–Tamir B, Sykes B, Torroni A: The emerging tree of West Eurasian mtDNAs: A synthesis of control–region sequences and RFLPs. Am. J. Hum. Genet. 1999, 64:232–249.View ArticlePubMed
            11. Watson E, Forster P, Richards M, Bandelt H–J: Mitochondrial footprints of human expansions in Africa. Am. J. Hum. Genet. 1997, 61:691–704.View ArticlePubMed
            12. Labuda D, Zietkiewicz E, Yotova V: Archaic lineages in the history of modern humans. Genetics 2000, 156:799–808.PubMed
            13. Cavalli–Sforza LL, Menozzi P, Piazza A: The History and Geography of Human Genes. Princeton University Press, New Jersey 1996.
            14. Ballinger SW, Schurr TG, Torroni A, Gan YY, Hodge JA, Hassan K, Chen K–H, Wallace DC: Southeast Asian mitochondrial DNA analysis reveals genetic continuity of ancient Mongoloid migrations. Genetics 1992, 130:139–152.PubMed
            15. Quintana–Murci L, Semino O, Bandelt H–J, Passarino G, McElreavey K, Santachiara–Benerecetti AS: Genetic evidence of an early exit of Homo sapiens sapiens from Africa through Eastern Africa. Nature Genetics 1999, 23:437–441.View ArticlePubMed
            16. Kivisild T, Kaldma K, Metspalu M, Parik J, Papiha S, Villems R: The place of the Indian mitochondrial DNA variants in the global network of the maternal lineages and the peopling of the old world. In: Genomic Diversity: Applications in Human Population Genetics (Edited by Papiha S, Deka R, Chakraborty R) New York, Kluwer Academic /Plenum Publishers 1999, 135–152.
            17. Comas D, Calafell F, Mateu E, Pérez–Lezaun A, Bosch E, Martínez–Arias R, Clarimon J, Facchini F, Fiori G, Luiselli D, et al.: Trading genes along the silk road: mtDNA sequences and the origin of Central Asian populations. Am. J. Hum. Genet. 1998, 63:1824–1838.View ArticlePubMed
            18. Brown MD, Hosseini SH, Torroni A, Bandelt H–J, Allen JC, Schurr TG, Scozzari R, Cruciani F, Wallace DC: mtDNA haplogroup X: An ancient link between Europe/Western Asia and North America? Am. J. Hum. Genet. 1998, 63:1852–1861.View ArticlePubMed
            19. Derenko MV, Grzybowski T, Malyarchuk BA, Czarny J, Miscicka–Sliwka D, Zakharov IA: The presence of mitochondrial haplogroup X in Altaians from South Siberia. Am. J. Hum. Genet. 2001, 69:237–241.View ArticlePubMed
            20. Horai S, Hayasaka K: Intraspecific nucleotide sequence differences in the major noncoding region of human mitochondrial DNA. Am. J. Hum. Genet. 1990, 46:828–842.PubMed
            21. Melton T, Peterson R, Redd A, Saha N, Sofro ASM, Martison J, Stoneking M: Polynesian genetic affinities with Southeast Asian populations as identified by mtDNA analysis. Am. J. Hum. Genet. 1995, 57:403–414.PubMed
            22. Soodyall H, Vigilant L, Hill AV, Stoneking M, Jenkins T: MtDNA control–region sequence variation suggests multiple independent origins of an "Asian–specific" 9–bp deletion in Sub–Saharan Africans. Am. J. Hum. Genet. 1996, 58:595–608.PubMed
            23. Watkins WS, Bamshad M, Dixon ME, Bhaskara Rao B, Naidu JM, Reddy PG, Prasad BVR, Das PK, Reddy PC, Gai PB, et al.: Multiple origins of the mtDNA 9–bp deletion in populations of South India. Am. J. Phys. Anthropol. 1999, 109:147–158.View ArticlePubMed
            24. Yao Y–G, Watkins WS, Zhang Y–P: Evolutionary history of the mtDNA 9–bp deletion in Chinese populations and its relevance to the peopling of East and Southeast Asia. Hum. Genet. 2000, 107:504–512.View ArticlePubMed
            25. Torroni A, Petrozzi M, Santolamazza P, Stellitto D, Cruciani F, Scozzari R: About the "Asian"–specific 9–bp deletion of mtDNA... Am. J. Hum. Genet. 1995, 57:507–508.PubMed
            26. Kolman CJ, Sambuughin N, Bermingham E: Mitochondrial DNA analysis of Mongolian populations and implications for the origin of New World founders. Genetics 1996, 142:1321–1334.PubMed
            27. Metspalu E, Kivisild T, Kaldma K, Parik J, Reidla M, Tambets K, Villems R: The trans–Caucasus and the expansion of the Caucasoid–specific human mitochondrial DNA. In: Genomic Diversity: Applications in Human Population Genetics (Edited by Papiha S, Deka R, Chakraborty R) New York, Kluwer Academic /Plenum Publishers 1999, 121–133.
            28. Rando JC, Pinto F, González AM, Hernández M, Larruga JM, Cabrera VM, Bandelt H–J: Mitochondrial DNA analysis of Northwest African populations reveals genetic exchanges with European, Near–Eastern, and sub–Saharan populations. Ann. Hum. Genet. 1998, 62:531–550.View ArticlePubMed
            29. Flores C, Hernández M, González AM, Cabrera VM: Genetic affinities among human populations inhabiting the Subsaharan area, Northwest Africa, and the Iberian Peninsula. In Prehistoric Iberia: Genetics, Anthropology, and Linguistics (Edited by Arnaiz–Villena A) New York, Kluwer Academic/Plenum Publishers 2000, 33–50.
            30. Krings M, Salem AH, Bauer K, Geisert H, Malek A, Chaix L, Simon C, Welsby D, Di Rienzo A, Utermann G, et al.: mtDNA analysis of Nile River valley populations: A genetic corridor or a barrier to migration? Am. J. Hum. Genet. 1999, 64:1166–1176.View ArticlePubMed
            31. Hammer MF, Karafet T, Rasanayagam A, Wood ET, Altheide TK, Jenkins T, Griffiths RC, Templeton AR, Zegura SL: Out of Africa and back again: Nested cladistic analysis of human Y chromosome variation. Mol. Biol. Evol. 1998, 15:427–441.PubMed
            32. Bandelt H–J, Forster P, Röhl A: Median–joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 1999, 16:37–48.PubMed
            33. Saitou N, Nei M: The neighbor–joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4:406–425.PubMed
            34. Finnilä S, Hassinen IE, Ala–Kokko L, Majamaa K: Phylogenetic network of the mtDNA haplogroup U in Northern Finland based on sequence analysis of the complete coding region by conformation–sensitive gel electrophoresis. Am. J. Hum. Genet. 2000, 66:1017–1026.View ArticlePubMed
            35. Ozawa T, Katsumata K, Hayakawa M, Tanaka M, Sugiyama S, Tanaka T, Itoyama S, Nunoda S, Sekiguchi M: Genotype and phenotype of severe mitochondrial cardiomyopathy: A recipient of heart transplantation and the genetic control. Biochem. Biophys. Res. Commun. 1995, 207:613–620.View ArticlePubMed
            36. Ozawa T, Tanaka M, Sugiyama S, Hidekazu I, Ohno K, Hattori K, Ohbayashi T, Ito T, Deguchi H, Kawamura K, et al.: Patients with idiopathic cardiomyopathy belong to the same mitochondrial DNA genes family of Parkinson's disease and mitochondrial encephalomyopathy. Biochem. Biophys. Res. Commun. 1991, 177:518–525.View ArticlePubMed
            37. Nishino I, Seki A, Maegaki Y, Takeshita K, Horai S, Nonaka I, Goto Y: A novel mutation in the mitochondrial tRNAThr gene associated with a mitochondrial encephalomyopathy. Biochem. Biophys. Res. Commun. 1996, 225:180–185.View ArticlePubMed

            Copyright

            © Maca-Meyer et al. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL. 2001