Skip to main content

Table 7 Characteristics of the microsatellite markers

From: The scurs inheritance: new insights from the French Charolais breed

Markers Forward primers 3'5' sequence Reverse primers 3'5' sequence Allele size range and (number)1
BMS1920 TCCCACCTACTTGGAAAATTG ATGACTCAATGACCAACTGACC 116–126 (6)
DIK4306 ATGGTGGCAATGGAGATGAT CATTCTTTCAGCTGCTAGGC 198–216 (6)
CSSME070 ATACAGATTAAATACCCACCTG TTCTAACAGCTGTCACTCAGGC 139–145 (4)
INRABTA19_01 TTGAAGTTTCTGGGCTTAAGGA TGTAGTTCTCAGGGCCAAGC 145–173 (11)
BMS2142 AAGCAGGTTGATGATCTTACCC GTCGGCACTGAAAATGATTATG 85–115 (11)
INRABTA19_02 GACAAGAGGCTCTGAAGAGAGG CATGTGTATTGGGTCTACAGCA 146–160 (6)
INRABTA19_03 TGAGACATGCATTCCCAAAT GGCCTCCAGAACTGAGAGAA 195–245 (17)
BP20 TCTGTGGGTGAACAAGCAAG GGCTCCCTAAAGACCCACTC 228–242 (6)
BMS2503 TTGAACAACTACCAGCTTCCC GACATGACTGAGCGCGTG 162–172 (5)
BMS2389 AATGTTAGGTTTACATGCAGCC AGGCAATAGGATCTCCACTAGC 91–113 (11)
DIK5224 TCTAGCTTCTCGGAGGTTGC CCTGGAATAGGTGGACCCTTA 167–197 (7)
  1. 1 according to genotyping results in our population.