Skip to main content

Advertisement

Table 1 PCR Primers

From: Co-assortment in integron-associated gene cassette assemblages in environmental DNA samples

PCR PRIMER SEQUENCE 5' > 3' COMMENTS
HS527/HS286 6-FAM, GGGATCCTC(S)GCT(K)GARCGA(M)TTGTTAG(V)C attC fwd
HS528/HS287 6-FAM, GGGATCCGC(S)GCT(K)ANCTC(V)(R)(R)CGTTAG(S)C attC rev
MRG 53b GATGGCGTCGCGAGTCAACC 258bp fwd
MRG 54 GCCTTGCAATCCGTCAGCCACG 258bp rev
MRG 55 AGTCAGACCTCAGGAACAAGAGC 347 bp fwd
MRG 56 CAGCCTTTGCTCTTACTGCGAACC 347 bp rev
MRG57a CTGCTTCCATTGTAAGAACACC 429 bp fwd
MRG58a TCGGCACAAGTACAGTCTATGC 429 bp rev
MRG59a TCTACGATCGCTATGGCAACGA 482 bp fwd
MRG60a TGAGCCAATATTGAGGCAAGCA 482 bp rev
16SF AGAGTTTGATCMTTGGCTCAG 16S fwd
16SR TACGGYTACCTTGTTACGACTT 16S rev