Skip to main content


Table 5 Primers used for PCR amplifications of candidate genes in P. vulgaris in the Core and wild collections

From: Molecular ecology and selection in the drought-related Asr gene polymorphisms in wild and cultivated common bean (Phaseolus vulgaris L.)

Gene Primer Name F/R Sequence (5′-3′) Ta (°C) Source Sequence*
Asr1 (region 1) ADOC01_01_Pv_12 F GAGGAGACTAAGCCCATAGA 62 IRD TC2798
** R ** **
  1. *Accession ID of the original EST sequences used to design the primers. TC accessions are from Gene Index (**The reverse primer ASR_TC2798_RV was also used in this case.