Skip to main content

Advertisement

Table 8 In-silico analysis of transcription factor binding site motifs at SNP sites in the PRKAG3 promoter region

From: SNP variation in the promoter of the PRKAG3gene and association with meat quality traits in pig

SNPs Putative transcription factors Predictor Recognition sequence Created with Start End
g.-995A>G CCAAT/enhancer-binding protein (α and ß) TFSEARCH CCCTTAGGCAATAT a A −1004 −991
   TESS CTTAGGCAATAT    
   MatInspector CCCCTTAGGCAATAT    −991
   Match™ ALIBABA2 CCCCTTAGGCAATATAGG    −991
      −1002 −989
      −1005  
  HNF-4 Match™ CCTTAGGCAATA AA c    −992
       −992
    CCTGCCCCTTAGGCAAT   −1005  
      −100 −1010
g.-480C>T Pax-4 Match™ CCGGGACCACCCACGAACTCC b, c C −481 −460
g.-461C>T SP1 TFSEARCH GCTGGGGAGGCGGAG a b C −472 −458
   TESS CGGAGT GGGGAGGCGGA   −462 −457
   ALIBABA2    −469 −459
g.-311A>G IK-1 Match™ TFSEARCH CGGTGGGAACACA a, c G −315 −303
g.-221G>A Myoblast Determining Factors MatInspector CGAGGACAGGTGAGAAG b, c G −221 −205
g.-30C>T RFX1 Match™ CTGTATCTGGGCAACAC b, c T −33 −17
  1. SNP positions in recognition sequence are underlined. No transcription factor motifs were found in positions g.-968G>A, g.-671A>G, g.-583C>T, g.-158C>G.
  2. a Transcription factor binding site prediction changes on substitution to alternate allele.
  3. b Minus strand.
  4. c Muscle specific.