Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer design for PCR analysis of MSTN candidate gene in Atlantic salmon

From: A SNP in the 5′ flanking region of the myostatin-1b gene is associated with harvest traits in Atlantic salmon (Salmo salar)

Gene SNP Primer Sequence (5′-3′) PCR product size (bp) TA(°C)
MSTN-1b g.1060C > A / g.1086C > T SaMSTNb23 AAACTGGGCATTCAATGTTCCACCATACCA 567 55
    CTGCAGTGGCTATTGGGAAAGCTCGCTAAT   
  c.3501C > G SaMSTNb33 ACTTGACGTACGAGCCGAGTTCC 571 50
    TTGCCGCAGCCACACCGACAAC