Skip to main content

Table 5 List of primers used for PCR amplification of DYZ1 array

From: DYZ1 arrays show sequence variation between the monozygotic males

Serial no. Primer ID Primer sequence Length (bp) Location Orientation
1 DYZ1 A CCATTCGAGACCGTAGCAATT 21 35-16 (5’ upstream to HaeIII site) 5’-3’
3 DYZ1 B ATTTGATGCCATCCCATGAC 20 763-782 5’-3’
5 DYZ1 C TCCTTTGCCTTCCATTCG 18 1668-1685 5’-3’
6 DYZ1 D TGCAGTCTTTTCCCTTCGAG 20 2564-2583 5’-3’
7 DYZ1 E ATTGGATGGGATTGGAATGA 20 861-880 3’-5’
9 DYZ1 F TCGAATGGAAGGCAAAGG 18 1669-1686 3’-5’
10 DYZ1 G CGACTGGTACGGACTCCAT 20 2637-2656 3’-5’
12 DYZ1 H TGGACAGCCTGGAATAAAGTG 21 3586-3606 3’-5’