Skip to main content

Table 1 Primer sequences used in the genomic amplification of exons

From: Analysis of human sarcospan as a candidate gene for CFEOM1

Exon PCR product Forward Primer Reverse Primer
  size (bp) (5'-3') (5'-3')
1 465 CCTCCATAATTCGAATACCAG CTGGGTTAGTCTCAACTCGAC
2 275 CGGACAGCTTTATAACATGGATG CTTAAGAAGGCACTCCTTTATTTTG
3 493 AATTCGCTTTGCAAATCATCATCC GTTTGTTTAACCTCAGCTACTC