Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primers for the characterization of the SAG gene

From: Screening of the arrestin gene in dogs afflicted with generalized progressive retinal atrophy

Exon Forward primer,
reverse primer (5'–3')
Exon (#)
and size (bp)
size (bp)
splice donor site (gt ),
splice acceptor site (ag )
1–2 GGGCAACCCTGTCCAGG (1) 156 836  
2–3 AGTGAAAGAAGCTACCAGGGA (2) 132 ~ 5500 ttcccag CTTGCT
3–4 AGGTGACCATCTACTTGGG (3) 61 ~ 2600 cctatag GTGACC
4–5 AGATGGTATCGTGTTGGTGG (4) 45 ~ 1800 ggtttag ATGGTA
5–6 AGTGTATGTCTCTCTGACCTG (5) 194 ~ 2000 cctccag TGTATGT
6–7 CAAGTTTTACACACTGAGTGCa (6) 60 ~ 1300 cccacag TTCCCTG
7–8 GTGCTGTGGGGTCGACTTT (7) 77 ~ 1500 actgcag TGCTGTG
9–10 CCTAGAAAGCCATGAGATTAAAa (9) 85 ~ 1500 ttttcag ATCTATT
10–11 TGGAACAAGTGGCCAACGTTa (10) 73 ~ 2500 tctgcag TGGAACA
11–12 GGACTGATGGTGGCTTTATGa (11) 138 ~ 3200 cctacag AGAAAAA
12–13 TGAGGGATGTGTTCATCTAGa (12) 78 1390 tgagcag AATAAAG
13–14 CTGGAGGTGAGCTCTCCCA (13) 24 ~ 1400 ttcctag CTTTCTG
14–15 AGTGAAGTGGCAACTGAGGT (14) 56 ~ 3000 tttccag TGAAGTG
15–16 CCTGCTCACGATTCTCTTTC (15) 16 426 cttacag CTACGGC
   (16) 237   tcttttag TTTTCA
  1. PCR amplification of the canine SAG gene: primers for the identification of exon/intron boundaries and for the determination of intronic lengths of the canine genomic SAG clones (exon sequences are shown in upper case) athe intronic sequences of the SAG gene received the EMBL accessions numbers AJ426068-AJ426078