Skip to main content

Advertisement

Table 2 Primers for the characterization of the SAG gene

From: Screening of the arrestin gene in dogs afflicted with generalized progressive retinal atrophy

Exon Forward primer, reverse primer (5'–3') Exon (#) and size (bp) Intron size (bp) splice donor site (gt ), splice acceptor site (ag )
1–2 GGGCAACCCTGTCCAGG (1) 156 836  
  ACACCCTGGGGTCTGTGTC    CACAAGgt acatg
2–3 AGTGAAAGAAGCTACCAGGGA (2) 132 ~ 5500 ttcccag CTTGCT
  ACCCACAGGCTCTACTTGT    AAGTCGgt aagtgg
3–4 AGGTGACCATCTACTTGGG (3) 61 ~ 2600 cctatag GTGACC
  AAAGTTCTTTCCTAGCACTAAGa    CTGTGGgt aagttg
4–5 AGATGGTATCGTGTTGGTGG (4) 45 ~ 1800 ggtttag ATGGTA
  ACCGTGAGCAGGAAGGG    AGAAAGgt aagaca
5–6 AGTGTATGTCTCTCTGACCTG (5) 194 ~ 2000 cctccag TGTATGT
  ACCTTCCCCATGTCTTGCG    CTCACGgt gggtg
6–7 CAAGTTTTACACACTGAGTGCa (6) 60 ~ 1300 cccacag TTCCCTG
  TCGCAGGCCACAGAGGAGAAGa    GGGAAGgt tagtg
7–8 GTGCTGTGGGGTCGACTTT (7) 77 ~ 1500 actgcag TGCTGTG
  CAGCACCCACAGCAGATTGa    CAAGAAgt aagagt
8–9 AGGAGGTCCGTGCGTTTTAC (8) 136 905 tctgcag GAGCTCC
  CTAATGCCTTTAATCTTCTTC    AAAGAGgt gagcca
9–10 CCTAGAAAGCCATGAGATTAAAa (9) 85 ~ 1500 ttttcag ATCTATT
  AAGCCAAGCATCCTACTTCC    CATTAGgt aggaac
10–11 TGGAACAAGTGGCCAACGTTa (10) 73 ~ 2500 tctgcag TGGAACA
  ACATGGTGCTGCAAGG    AACACAgt gagtag
11–12 GGACTGATGGTGGCTTTATGa (11) 138 ~ 3200 cctacag AGAAAAA
  ACCCTGACACCGTGAGCTTC    CACCATgt gagtcc
12–13 TGAGGGATGTGTTCATCTAGa (12) 78 1390 tgagcag AATAAAG
  TTCATAACACCTCTGAGCTACa    GTCAGGgt gagtgt
13–14 CTGGAGGTGAGCTCTCCCA (13) 24 ~ 1400 ttcctag CTTTCTG
  GTGCTCAGGGACCACTAG    CTCCAGgt aagcct
14–15 AGTGAAGTGGCAACTGAGGT (14) 56 ~ 3000 tttccag TGAAGTG
  AAGCCGAAGACTGGGAGCa    ACCCAGgt cagtcg
15–16 CCTGCTCACGATTCTCTTTC (15) 16 426 cttacag CTACGGC
  GTCCAGGTCGACCGACCT    GGAAAGgt gagccc
   (16) 237   tcttttag TTTTCA
  1. PCR amplification of the canine SAG gene: primers for the identification of exon/intron boundaries and for the determination of intronic lengths of the canine genomic SAG clones (exon sequences are shown in upper case) athe intronic sequences of the SAG gene received the EMBL accessions numbers AJ426068-AJ426078