Skip to main content

Advertisement

Table 3 Primer sequences used for mutation analysis of individual exons/introns of the canine SAG gene

From: Screening of the arrestin gene in dogs afflicted with generalized progressive retinal atrophy

Primer Location Forward primer, reverse primer (5'–3')a PCR conditions [T-°C/MgCl2-mM] PCR amplicon length (bp) Restriction enzymes for SSCP analyses
UTR1F exon 1 GGGCAACCCTGTCCAGGT 54/1.0 699 Nla III/Rsa I
UTRI-1aR intron 1 TCTATCATGACGGGACGCCT    
UTRI-1aF intron 1 GAAAATGATATTTGCAAAGCAG 50/1.0b 283 Tru 1I
UTRI-1aR intron 1 TCTATCATGACGGGACGCCT    
1-IF intron 1 CTAATGGGCACACAGCATCTC 53/1.0 249 Pvu III; Nla IIIc
2-I2R intron 2 TTCTGTTAAGCCACTCACTTC    
3-IF intron 2 TGTTTTTATCTAACACTGACTACTTC 48/1.0b 224 Nla III
3-IR intron 3 AAATAACAAAGTAGCAGCTGTC    
4-IF intron 3 AACTGCAGATAAATATATGAAG 52/1.0 189 Alu I
4-IR intron 4 AAAGTTCTTTCCTAGCACTAAG    
5-IF intron 4 GGTTACCCCATGTTCACTTG 56/1.0 343 Mnl I
5-IR intron 5 GCTCCTGGTCACACTGCAAG    
6-IF intron 5 CAAGTTTTACACACTGAGTGC 55/1.0 213 Alu I
6-IR intron 6 ATTTTCCCCAGAGAAAAGGCTA    
7-IF intron 6 CGGGAAGGGAGGTGCTGA 58/1.0 233 Rsa Ic
7-IR intron 7 TCGCAGGCCACAGAGGAGAAG    
8-IF intron 7 ATCACAGCGTGAGTACGGGGAG 55/1.0 288 RsaI; Pst Ic
8-IR intron 8 CAGCACCCACAGCAGATTG    
9-IF intron 8 CCTAGAAAGCCATGAGATTAA 55/1.5 214 Tru I1; Sty Ic
9-IR intron 9 GACCAGACTGAGAAATTCTAG    
10-IF intron 9 GGCACCATGCACATGCGTG 58/1.0 235 Alu I
10-IR intron 10 AAGCCAAGCATCCTACTTCC    
11-IF intron 10 GGACTGATGGTGGCTTTATG 58/1.0 266 BsuR I
11-IR intron 11 AGCAGACCAGCACCTCCTC    
12-IF intron 11 TGAGGGATGTGTTCATCTAG 55/1.0 183 -
12-IR intron 12 GCCCATGGTGTTGGCTCTTG    
13-IF intron 12 CATGCTTGGGACATGTCCAC 64/1.0 209 Mva I
13-IR intron 13 TTCATAACACCTCTGAGCTAC    
14-IF intron 13 CTCTGCAGCCACAGCCCTTC 50/2.0 229 Ava II
14-IR intron 14 GTGCTCAGGGACCACTAG    
15-IF intron 14 CCTGCTCACGATTCTCTTTC 58/1.0 244 Hph I
15-IR intron 15 AAGCCGAAGACTGGGAGC    
16-IF intron 15 GATCGGTCCCTTGTTGCA 52/2.0b 347 Alu I
16-ER Exon 16 CACAGCTGAACAGACAAACTT    
  1. aSee EMBL accession numbers AJ426068-AJ426078 bwith 5% formamide cwith RLFP analysis