Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 3 Primer sequences used for mutation analysis of individual exons/introns of the canine SAG gene

From: Screening of the arrestin gene in dogs afflicted with generalized progressive retinal atrophy

Primer Location Forward primer, reverse primer (5'–3')a PCR conditions [T-°C/MgCl2-mM] PCR amplicon length (bp) Restriction enzymes for SSCP analyses
UTR1F exon 1 GGGCAACCCTGTCCAGGT 54/1.0 699 Nla III/Rsa I
UTRI-1aF intron 1 GAAAATGATATTTGCAAAGCAG 50/1.0b 283 Tru 1I
1-IF intron 1 CTAATGGGCACACAGCATCTC 53/1.0 249 Pvu III; Nla IIIc
4-IF intron 3 AACTGCAGATAAATATATGAAG 52/1.0 189 Alu I
5-IF intron 4 GGTTACCCCATGTTCACTTG 56/1.0 343 Mnl I
6-IF intron 5 CAAGTTTTACACACTGAGTGC 55/1.0 213 Alu I
7-IF intron 6 CGGGAAGGGAGGTGCTGA 58/1.0 233 Rsa Ic
8-IF intron 7 ATCACAGCGTGAGTACGGGGAG 55/1.0 288 RsaI; Pst Ic
9-IF intron 8 CCTAGAAAGCCATGAGATTAA 55/1.5 214 Tru I1; Sty Ic
10-IF intron 9 GGCACCATGCACATGCGTG 58/1.0 235 Alu I
11-IF intron 10 GGACTGATGGTGGCTTTATG 58/1.0 266 BsuR I
12-IF intron 11 TGAGGGATGTGTTCATCTAG 55/1.0 183 -
13-IF intron 12 CATGCTTGGGACATGTCCAC 64/1.0 209 Mva I
14-IF intron 13 CTCTGCAGCCACAGCCCTTC 50/2.0 229 Ava II
15-IF intron 14 CCTGCTCACGATTCTCTTTC 58/1.0 244 Hph I
16-IF intron 15 GATCGGTCCCTTGTTGCA 52/2.0b 347 Alu I
  1. aSee EMBL accession numbers AJ426068-AJ426078 bwith 5% formamide cwith RLFP analysis