Skip to main content

Advertisement

Table 3 Primer used for genotyping

From: Variants in the vitamin D receptor gene and asthma

SNP left primer right primer extension primer stop mix
hCV2880804 ACGTTGGATG-CTGGGATACTTCTGAGAGTG ACGTTGGATG-TTTTCCCTGGAAAGTTTGGG CCATTGTCCTGGTATAACCA ACG
rs2228570 ACGTTGGATG-TCAAAGTCTCCAGGGTCAGG ACGTTGGATG-AGACCTCACAGAAGAGCACC CCCTGCTCCTTCAGGGA ACG
rs3819545 ACGTTGGATG-AATGGTGGTTACTGCAGCTC ACGTTGGATG-GAAACCAGTCCTCTGTCATG TAGGTTCGGTCTTTGGCT ACG
rs3782905 ACGTTGGATG-GGGTCTCAAATTCTTAATGAG ACGTTGGATG-AAACTAGCAGAAAGAGGCAG GTGGGAGGGAGTGCTGA ACT
rs2853564 ACGTTGGATG-CTGCATTGCTCCTGACTTAG ACGTTGGATG-AGGTAGCTTAGCTCTGAGTC TTTCTGCAACCCTAAGCC ACT
rs731236 ACGTTGGATG-TGTGCCTTCTTCTCTATCCC ACGTTGGATG-TGTACGTCTGCAGTGTGTTG CGGTCCTGGATGGCCTC ACT
rs1544410 ACGTTGGATG-TAGATAAGCAGGGTTCCTGG ACGTTGGATG-AATGTTGAGCCCAGTTCACG AGCCTGAGTATTGGGAATG ACG
rs2239185 ACGTTGGATG-CAATTCCAGTCACATCTCGG ACGTTGGATG-CCTGTGTGACATTTACACCC CCCTCCTCTGTCTTCAC ACT
rs987849 ACGTTGGATG-GAATAGTGCCTTATAGATAG ACGTTGGATG-AGCTAGAAGTTCTGGTGATC GAAATATTCGTAATGCTGGAT ACT
rs1540339 ACGTTGGATG-TCACACACATTCTCAGTGGG ACGTTGGATG-TTTGCAGAGGCTGTCTTCTC GTTGGTGCCCACCCTAA ACG
rs2239186 ACGTTGGATG-GTCCACAGTGACTATAGACC ACGTTGGATG-AAGAAGGAGAAGCAGGCATC CAGGGGTGGAAGAAGAGGAG ACT
rs1989969 ACGTTGGATG-TGTATGCAGAGCTTAGCAGG ACGTTGGATG-TTTCAGAGGTCAGAGGTGAC GTCAGAGGTGACATCCAG ACT
rs2853564 ACGTTGGATG-CTGCATTGCTCCTGACTTAG ACGTTGGATG-AGGTAGCTTAGCTCTGAGTC TTTCTGCAACCCTAAGCC ACT