Skip to main content

Advertisement

Table 2 Primer sequences for the sequencing of horse PMEL17

From: A missense mutation in PMEL17 is associated with the Silver coat color in the horse

Primer sequence Forward primer (5'-3') Reverse primer (5'-3')
5'UTR-Intron1 GGATCCCTTGTCAGTTTTGC AGGAGAGGAAAAACCAGAGC
Exon 1-Exon 2 (LR) GATGGATCCAGTGTCAGAGATG ACTCTGGATACAGCTGCCTGTT
Intron 1-Exon 2 CGTGGGATGACGTTATCTTCT AGTCAGGCCCCTGAATTTCT
Exon 2–3 GTCTCAAGGCAGCTCAGGAA CATTGATGATGGTGTTGTTGG
Exon 3–4 (LR) CTACACTGGTTGGGGCAAAT TCTGAGACAGAGGGCCAGAT
Exon 3-Intron 3 GGTGGCCCTGAAGATCAGTA AGGGAATTGGAGCCCTTAGA
Intron 3-Exon 4 CTCTCTGGGAGCCGTGTTAG CCCAGGTCTTCCAGACGTAA
Exon 4-Intron 4 TCCCCAGGAACCTGATGATA CTTCAGAGGTGGGACCAGAG
Exon 4–5 TCCCCAGGAACCTGATGATA GCGGTGGTAGACAGTCACTT
Exon 5–6 AGTGTCGGGGCTGAGCAT CAGGCCACAGCTTGTCTTTT
Exon 5–6(2) TGCCCCTCGCTCACTCCCGCTCAGCCT CATGAATGGGCTGGCATCTGGA
Exon 6–7 GGTAACGGTACAGAGTTGGTGGAA GGACGATGTCCAGAGTGAGGGA
Exon 6–7(2) AGGTGCCAACTGCAGAGC GGACGATGTCCAGAGTGAGG
Exon 7-Intron 8 ATGGCACAGCCACCTTATTC GAAAGGTGTCAGTTTAGGTCAGG
Exon 7–10 CCAGAGCCCCCTGCTGGATGG TATATCAGAGATGCAAGCACCATA
Exon 9-Intron 10 AATGTGTCTTTGGCTGATGC TCTGCCCCTCTTACAGGTGA
Intron 10-Exon 11 GCAGGGAAGCTTGTAGAGTGA CTCTCACCAAAGGGGGAAG
Exon 10–11 AGAGGCAGGCCTTGGGCAG TGCTCTCACCAAAGGGGGAAG
Exon 11–3'UTR CAGGCGCAGACTTATGAAGC AGGGAAGWCTGSRGRAAABA
Pyroseq. PCR primers, Ex 11 Biotin-TCCATTGCTTACCAGTTTCCTT CTCACCAAAGGGGGAAGAG
Pyroseq. Seq primer, Ex 11 - GCCCTGCTTCATAAGTCTG
Pyroseq. PCR primers, Int.9 CATGCCTGGTAGGTACTTGGA Biotin-CCTCTTGACCTGTGAGCAGA
Pyroseq. Seq primer, Int 9. GGGGAGTGGGCAGAGGCT -
RACE primer - CCGGAGGGCAAAGGTCAGAGGTTG