Skip to main content

Table 1 Primer sequences for the CAPN3 single nucleotide polymorphisms

From: Variation at the Calpain 3 gene is associated with meat tenderness in zebu and composite breeds of cattle

SNP Name 5'-3' sequence
CAPN3:c.53T>G   
MGB-probes CAPN3E6100T 6FAM-TGAGCCCATGTCC
  CAPN3E6100G VIC-TGAGCCCAGGTCC
Primers CAPN3E6G100TU1 ATGCCGACCGTCATTAGC
  CAPN3E6G100TD1 GAGTAGATGCCACTTGGGTTTC
CAPN3:c.1538+225G>T   
MGB-probes CAPN3JK-V2-642G VIC-TACACGCTCACATGC
  CAPN3JK-V2-642T 6FAM-ACACTCTCACATGCT
Primers CAPN3JKG642TU2 ATTGCATGGCCTCCTGAC
  CAPN3JKG642TD2 CTCCAGAACACCTCTGGACTG
CAPN3:c.2443-103G>C   
MGB-probes CAPN3X3-266G 6FAM-CTTCCGTGTCTGGC
  CAPN3X3-266C VIC-TCTTCCCTGTCTGGC
Primers CAPN3X3G266CU2 AGCCTCAGTTATGGCTTTATGC
  CAPN3X3G266CD1 AGATCAGAATGCACAATGAGACA