Skip to main content

Table 6 Primer sequences and PCR conditions.

From: A multilocus assay reveals high nucleotide diversity and limited differentiation among Scandinavian willow grouse (Lagopus lagopus)

Gene Primer sequences Step lengths (s) (annealing/extension) MgCl2 (Mm) No. of cycles Ta (°C)
AKR F: GTCTGCAACTGGTTTATCAAC
R: TTAGGCCATGAGTTTTGCCTG
30/45 1.5 33 50
APOA F: CCTGAAGCTGGCTGACAACC
R: TCAGGCCACGGACTTCTGG
30/45 1.5 38 50
BCL-2 F: GAGAAGAGGCTACGACAACC
R: CCATCCTCCGTTGTCCTGG
30/45 1.5 33 50
BCL-X F: ATGTCCAGCAGTAACCGGG
R: CAGCCGCCATTCTCCTGG
30/45 1.5 33 50
BRIP1 F: GTGGCCAGAAAGTTGATGTAG
R: CTATGTGCTAGTACTGTCCAG
45/60 2.5 40 50
CAAX F: CACTGCTGGAGAGTTCTTCC
R: CTAGGAAATCCTGCAGCAC
45/60 1.5 35 55
CXCR4 F: TCCTCTGGCATACTCATTG
R: GCTGGAATGGAAACTTGAAG
45/60 2.5 40 50
EPN2 F: GACGACTTCATCTATTAGGCG
R: AGCCATGGTAGGATGCTGGAG
45/60 2.5 40 50
KELCH F: CAGACCACTTCATGAACAAAG
R: CTTATCATGCAGCGTGGTTG
45/60 2.5 40 50
LEPR F: CCTGAAACTTTTGAGCAYC
R: TTAACAGCTGTTCTCTGTGG
45/60 2.5 40 50
MBL F: ATCATCAAGCGCATCATCGG
R: TCATCTCTCCAGCTCAGGG
45/60 2.5 40 50
MICRO F: GTGGACGGTGGAGGATTGCTG
R: GTGTCAATGCTCTGCGCTTC
45/60 2.5 40 50
NGF F: ATGCCAGATGGAACAGAAG
R: TCAGGGTCTCCCCGATTTC
30/45 1.5 38 50
PKP4 F: CCTTCAGCAAACGTTGCTAC
R: TGTAAGGCTATCTGGACGTG
45/60 2.5 40 50
PPARG F: GACATGAACTCTTTAAGGATGG
R: CTCCACTTAGTATAATGACAGC
45/60 2.5 40 50
TAR F: TTGCCCAGTCTCTTTGTGGAG
R: CTACATTCCCCAGCCTGA
45/60 2.5 40 50
TRANS F: GAGCTGGTGCAGAAGATCAG
R: CTCCGGTATAGAGGAAGGAG
45/60 2.5 40 50
YTH F: GTGAAGCGCCATGGTCTAC
R: GGACTCACCACTTGGAACAG
45/60 2.5 40 50