Skip to main content

Table 1 Summary data of microsatellites La Gomera Giant lizard ( Gallotia bravoana ) for all loci (A) for wild individuals (B) and for captive samples (C)

From: Island survivors: population genetic structure and demography of the critically endangered giant lizard of La Gomera, Gallotia bravoana

A) Loci   Locus Repeat motif Ta (°C) Primers sequence 5’-3’ Allele range N N A N AR H O H E F IS 1 GenBank No.
  GBR5   (CA)10 60 F: ATATTCATCCTCCCCGCACA 177 90 1 - - - - JX661253
F: GCATTGCGGTGAAAAAGG
  GBR9   (GT)17 60 F: TGGAGGCTTCTCTTGAGGCAAGA 138-160 98 4 3.9 0.143 0.153 0.066* JX661254
F: CCCCCTGCCTTATGAGTTTCG
  GBR11   (GTCT)6 (ATCT)12 60 F: CTTAACCGTCTGGTTTGCATTA 196-215 96 2 2.0 0.000 0.021 1.000* JX661255
F: ACTGCACCCCATAGTTGTCTTT
  GBR15   (CA)27 60 F: ACTGGGGCTCAGTCTTTGTTT 140 91 1 - - - - JX661256
F: GCGTGTCTTGTGTATATGGAATC
  GBR16   (CA)14 60 F: GCAGATTTAATGGAACCTGGAG 224-238 91 2 2.0 0.011 0.033 0.664* JX661257
F: CAACAAAATGTGGAGTTTTAGCC
  GBR20   (GT)16 (GTAA)7 60 F: CCACAACAAAACAAATGCAA 190-217 97 5 4.9 0.051 0.081 0.362* JX661258
F: GTCAGATCGACCCTCTCAGC
  GBR24   (CA)28 60 F: ACTTGCAGACTATTTTGGGTT 129-167 96 4 3.9 0.531 0.512 -0.039* JX661259
F: ACTCGCATCCTTCTGTTACAA
  GBR26   (CT)15 (CA)13 60 F: TGGCCACACGAGATTATTCA 103-164 90 7 7.0 0.100 0.139 0.282* JX661260
F: ATATCGGGCCHTTTCACA
  GBR28   CA)26 60 F: ACAACACGCCTCAGTTCACA 195 89 1 - - - - JX661261
F: GCTGCCTTGAGTGAGTCTCC
  GBR29   (GT)110 60 F: GGCGTGCTTGTGTATAGGAA 132-174 97 3 2.9 0.010 0.031 0.666* JX661262
F: CCCAGCAGGGTTGCTTAG
  GBR30   (CA)13 60 F: CGCACACTTATCCTGTCGTG 198-206 98 2 2.0 0.010 0.030 0.664* JX661263
F: GACAGTGAGTCATGTGTGCATTT
  Mean (all indiv.)2       84.9 3.6 3.6 0.107 0.125 0.142*  
B) Wild individuals GBR9       56 3 2.9 0.180 0.179 -0.90  
  GBR20       56 2 2 0.053 0.052 -0.019  
  GBR24       54 2 2 0.494 0.490 -0.127  
  GBR26       53 4 4 0.074 0.073 -0.017  
  GBR29       59 2 1.9 0.036 0.036 1.000*  
  GBR30       56 2 1.9 0.018 0.018 0.000  
  Mean (all wild indv.)       55,7 2.5 3.1 0.143 0.141 -0.052  
C) Captive samples GBR9       42.0 3 2.98 0.114 0.115 0.382  
  GBR11       41.0 2 1.99 0.048 0.048 1.000  
  GBR16       36.0 2 2.00 0.080 0.081 0.660  
  GBR20       41.0 5 4.62 0.117 0.119 0.592  
  GBR24       42.0 4 3.71 0.475 0.481 -0.040  
  GBR26       37.0 7 6.92 0.226 0.229 0.413  
  GBR29       42.0 2 1.86 0.023 0.024 0.000  
  GBR30       42.0 2 1.98 0.046 0.047 1.000*  
  Mean (all captive indv.)       40.4 3.4 3.26 0.141 0.143 0.511  
  1. N= number of individuals assayed. N A = number of alleles per locus. N AR =allelic richness standardized to the smallest sample size using the rarefaction method of FSTAT 2.9.3 [73]. expected (H E ) and observed (H O ) heterozygosities. F IS = Wright’s statistics.
  2. 1Bold F IS values are significant probability estimates after q-value correction (*p<0.05).
  3. 2The mean values were calculated only with the polymorphic loci data.