Skip to main content

Table 4 List of the primers sequences used for qRT PCR

From: An integrated in silico approach for functional and structural impact of non- synonymous SNPs in the MYH1 gene in Jeju Native Pigs

Genes name CDS region Primer sequences Annealing temperature (Ta) Product size Genebank IDs
MYH1 42….5861 F 5′ AAGGGACTGTCCAGAGCAGA 3′ 55.0 °C 225 NM_001104951.1
R 5′ CACAGAAGAGGCCCGAGTAG 3′
GAPDH 101….1102 F 5′ AGAAGGTGGTGAAGCAGG 3′ 61.0 °C 170 NM_001206359.1
R 5′GTCGTACCAGGAAATGAGC3′