Skip to main content

Table 2 SSR primer sequences used for amplification in 32 O. viciifolia individuals and characteristics of SSR motifs

From: Characterization of novel SSR markers in diverse sainfoin (Onobrychis viciifolia) germplasm

Marker Motif Repeats Predicted size Forward primer (5′–3′) Reverse primer (5′–3′)
OVK002 AG 9 164 CCCACCAGACAAAAAGAATA GCTTTCCCCTTCATCAACTAT
OVK003 TA 8 122 GATAGAATTCGTTTGTTGGTG ATCTTTGTAACTGTTCGCTCA
OVK017 AC 8 158 GGGTGTTAGTTATCCATTTCC ACATACTAGCCTTCTGGGGTA
OVK027 CTCG 6 129 AATGGAATCTCGGAGACAG GGAAGAAGACGAAGTAGTAGGA
OVK034 GCT 6 150 GTGAGATGAGCTTGGACATT AGATAACTAACTGCAGGCAAG
OVK036 AGGT 6 150 GTGTTAAAGGGGTGAAAACAT CATTTTGACAAACCAGTATCC
OVK038 ATT 6 166 CCACATACGAGACAGAATAGG CTGAAAATTGATCGATACTGG
OVK042 GTT 6 144 GGAACGGTTAATTTCTGATTT AGAATTCCGTACAAGTCGAG
OVK045 AGA 6 148 CCAAAAATCATCAATCAACAC TTGAACAAGGGTTAGGGTTAT
OVK046 AGTG 6 151 TCAACCACATTATAAAACCTCA CGCGAAATCATAGTTCACTT
OVK054 GAA 6 201 TTGCAGAGATAACACTCACCT TCCTGAAAAACCTAATCACAA
OVK055 GAT 6 189 GAAGATATTTCAAAGCAGCAA CATGCTACCACTAGCAGAAGT
OVK063 TTG 6 188 AATTGCAACTGAAACTGAAAC ACTGCTACCCTCTCCATAAAT
OVK068 GGA 6 195 GACCACCCGCAGCTCAAC GTCTTCTTCCCCCATATTTAG
OVK072 ACC 7 199 TTGCCTTAGTCAGTTACCTTG GTGGAGAGAATGAGAGAACCT
OVK073 GAC 6 200 GTAGACAACCGTATCTGGACA AAGATGGAAGGTTCTAGTTCG
OVK077 TTA 6 249 GTCCCTCTCTCTCAAATTGTT AGGTTAATGGAGCTTAGTGGT
OVK089 CAT 6 257 CAAAGTCATACCAATCACCAT TCTTGGAAGCACTTGTTACTC
OVK093 CCA 6 259 CCAAGTGTTTGAAAGTCTCAG TGAGAGTTCGTTCAAGGTAGA
OVK094 TTGCG 5 255 ACCGATCTTAGGATAGATGGA ACTTTTGGTTGCTTAGTCGAT
OVK096 TCA 6 249 GAGCGTTGCATTTACATTTAC CATCCTCCTTTACACCCTAAT
OVK097 GTGA 6 252 TCTATAGAGATGAGGCGACAA CGCCCCTAACTAACCTACTAC
OVK099 TGAG 6 247 AGAAAATGGAAGCAACAGAGT ACAAATAGCAGCTCCCTTC
OVK101 CTAA 6 254 GTTGAGTTTCAGACACAGAGC AATAGCTCCCACAATAACTCC
OVK102 TGT 6 249 CCAAAGGGTGTTTTATTTTCT GGAAGAAATTAAGCAAATGGT
OVK107 AG 8 193 AAGTTAAAACTTTGCGTTGTG GACGTTGTTCTGGATTTCTTC
OVK111 GGT 7 206 TATAGACCTTCTCCTCCCAGA GTGAAAGTCACAAATCCAAAG
OVK119 CAG 6 199 ACCCTCCTTCTCTCCTTATTT GACGAGAGAACTCGTTTATGA
OVK122 TC 9 211 GCAGATAGCACAGTTATCGAC GAACCACACACACAGAATCA
OVK123 ACA 9 200 CACCCATTAACTATCATGGTC CAAGCCCTTTGTGAGATACTA
OVK124 TGA 9 211 GCCTTTTCTGTGACTCGTAA GCTCCATTCCCATTTATAGTT
OVK125 CATTT 5 193 AAATTTAAGCACCGGAATAAC AAAGCAAAAGGGCTACTAAAG
OVK126 TC 8 197 CGACAAAACTATTTAGGCAAA GGGAAGAGATCATAAACCCTA
OVK127 AT 8 200 GCCCAAAATGTATTATCCTTC AGAACAGACAGATATGCAAGC
OVK131 TA 8 200 TCTATCTGGGTGTTGTTTTGT CTGTTTGAATATCGATTACCAC
OVK133 TG 8 196 TGCTTCAGCATTATTGTAACAT TGCACTTCTCCATACTTCCTA
OVK138 CTAA 6 250 TAATATGGTGCAAGTTCCAAT TTCTACGCTTAGCTCAAACC
OVK141 CACG 6 239 GAGGAGGTACATACAGCACAG CAACCTCCTCGTTATCTTTTT
OVK142 GT 8 243 AACATGACTACTGTGAACAAGG CGAACATGTAATTGATCCAAG
OVK155 GTG 6 251 CAGGTTTGAAGTAGCAGAGAA GTAGACCACGCATACTGAATC
OVK158 GACT 6 257 TCAGAGTGTGTTGTGTTGTGT AGTGAAGCAAATGTGTGATTT
OVK159 TG 8 251 CATTATTGCCTAGCATTGTTC ATTTCACCATCAAGTATGCAC
OVK161 TTCC 6 249 AAAGCTTTCTACACGTTGGTA TGGGTTTTTACACTCTGTGAT
OVK165 ACA 6 267 TTTCAAACACTCACTCACTCC TCGGATTTGTGACCTAACTC
OVK168 TGA 6 253 AATTATCACCCACTGCTATGA GGTTTCCATCACTGTTTGTTA
OVK172 AGC 6 256 TTATTAAACCTGCGTCTTCTG GTAGAGCTGTGGGCTTTATCT
OVK173 CT 8 253 TCGTTCTCGTGATTATTCTGT CCTCTATTCAAATAGGGCAAT
OVK174 GGCCC 5 246 ACATGATCGTGAATATGAAGC CAGCAGCAATCAATATATCATC
OVK175 CA 9 250 GTAAAATATCAAGCAGGAGCA AAACTATGCAGACACCCTGTA
OVK177 CTG 7 257 TCTGTTGATTTAAGGAGACGA CTCTTGCTCATATTTTCCTCA
OVK181 AAG 6 257 AGGAAGAAGAAGAAGAAGCAG TTCTCCTTTAACCACAACCTT
OVK183 TGAT 6 256 GAGGGTAAGAGAGAGTGGAAG CTTGCCTGATATCTTCTCAAA
OVK196 AGC 6 286 TTTTGAGAGTGTGGAAGGTTA AGTATGAGCCTGATGATGATG
OVM003 TC 9 297 CCGTCTGTTTAATCATTCACT GAAAGGAAAGGTTATTGGAGA
OVM004 ATTT 5 290 GGGAATTCTTAAATCTCATGG ATGCATGGTACTGGGTCGT
OVM025 CAA 6 297 TTCTGAACAACAACAACAACA GTCCAGGAGCTAAGTAACCAT
OVM031 TGA 6 306 ATTGGTTTCTAAGGAGGACTG GCAATACTCCTCTGCCTAGTT
OVM033 CTC 6 300 CAAGGCTTATTTGGTTAACAG ATACTATTTCCCATGCCTACC
OVM034 TTC 6 308 GCATTTCATCAAACACTTTTC TTGGTTTGAATCTGTGAGACT
OVM035 TTC 7 303 TCATCAAACACTTTTCGTTCT TTGGTTTGAATCTGTGAGACT
OVM038 GAAG 6 297 CACAGGACAAGAGTGAGAGAG TCATGATACCACGAATTTTTC
OVM043 GAG 7 167 TAGTATGGCTGAAATCAAAGG ATATCATAAGGGCAACAGTGA
OVM048 AT 9 157 GACATTGAAATCAAACAATCC AACACTTGTCATGTTTCCAAG
OVM049 TGA 7 150 AACAAACAAGAGGAAAAGGAG TATGTGCTTATCAGGCATTTT
OVM050 ATCC 6 161 ATGAGCATGAAGAGTTTCAGA ACACATCTACGACTTCTTTCG
OVM053 GTGGA 5 149 CACCAAAAGCATAGCAATAGT GCTTGAATTGAATGAGAAATG
OVM057 TTG 6 153 CCTTGAGGAGGAATAATAGGA GACATCATCATCACCTTCACT
OVM058 AT 9 150 GTCAAGTCATACCCATACGAG CAGTGTAACCATATGCACAAA
OVM059 AGA 6 149 ACTCCAACTCCAACTCAGAAC AAGCGAAGAAGAGAGTGAGAT
OVM060 CT 8 159 ATGTAATCAAAAGGTGCAGAA AGCTTCCAAAACAGTGTATGA
OVM061 GTA 6 150 TTAACACACGTACGTACCACA TTTGTCGTTGATCGTTAAGTT
OVM062 AG 8 139 GGAAAAAGGTTTGGATAGATG AAGTTTTCCCCACACTATTCT
OVM064 AT 8 353 GCATGCACAGAATTAAGTTTC AGAAGGTCCTTTGAAAATCAG
OVM065 CT 8 352 AAGACAGCGAGTTACCAATCT GATTGAAACTGAGTAGCGATG
OVM067 CTT 6 352 CAACCTTAATACCAACCTTCC AAAAGTAGCCAGAGAGCAAAT
OVM068 CCT 6 333 CTACAACTCACCGAAACTCAC CGATTTCTGCCTCTTTATTCT
OVM069 AATG 6 357 ATGTTGTACAGATGAGCTTCG TAGTGAGCAAACCTATTTTGG
OVM072 GAA 6 350 TTGATGTGGTTGATCCTATTC GATGTCAACATCTTGGTCATTA
OVM073 ACA 6 346 GTTCTCAAACGCACTATCAAC AAAATCTTGTAGGGATTCGAT
OVM076 AAC 7 348 CCCATTCTTCATCTTTCTCTC TGCTTCCATAATCAGTGAAAT
OVM081 GT 9 350 TCTAGCACAATGTTTTGGATT TATTGAGTTGAAGCAGACCAT
OVM083 CT 8 347 CACACAAACACAAAACTCACA GATCGGAGAAAAGAAGAAGAG
OVM086 GAA 6 350 TCATACAAAGTTCCTTCCGTA ATTGCCAATAACAGTGAAGAG
OVM090 CCA 6 151 AATCAATGGAGGAGGATAAAC GAAGGTTGAAAAGGGAATAAA
OVM091 ATC 6 188 AACCACCCTTAATTCCATAAG AGATAAAAGCCGCAAAAGTAT
OVM092 CAC 6 157 GGACCAACAAAGAGGATTATT CCCTTGCTTGAAGTGTTACTA
OVM094 GTTT 5 163 ATTCATGGGGACAATAAATTC CAAGAGAATGAATGAATCAGC
OVM099 GA 9 149 TATGTATTGCAGAATCACAGC TATTACCCTTTTCCATCTTCC
OVM100 AAG 6 151 GAACTAGATTTGCGGCATT CCCACACCCTTATCCTTATTA
OVM110 AT 8 154 CTGGACGAAAACAACATATTC GTTGGCTTTGGTACTGACATA
OVM116 GAT 7 151 AACTACACGCACGTAATGAAT TGGTTTGATAAACACCTCAAG
OVM120 TTC 6 152 TTCAGTGTCACTTTCCTCATT AGAAGTTGTCATGTCAAGGAA
OVM122 TGG 6 156 ATGAATCTTGTACGGAATCTG GAAGAAAAAGCCATAAACACC
OVM125 AAATT 5 151 ATTCTTTCAACAAGCAAGTGA CTGCAATTCCATCCTATTTTA
OVM126 TCC 6 188 ACTAAGAACCACCCAAAACAT TGAGAAGATGGAGAAGATGTG
OVM128 TGTT 6 155 GAGAAGCATAACCAAAATCCT TGGAAGAAAAGAAACTTCTGA
OVM129 TG 8 133 AATTGGATTCATGTGTTAGGA GAAGTGGAGCCAAAACCT
OVM130 AG 9 154 GCAAATTATCACCATGCAC CGTGAAGAAAATCGGTACTTA
OVM131 AGA 6 153 GAAATAACGCAGGCAGATAC AATTAGAGGCTTCGACTTGTT
OVM132 GAC 6 142 ACGGTAATCAGTAGTGACAGC GTGTGACAGAAAATGGGATTA
OVM133 TTTC 5 171 TAGCATCAAGGTTGGAAATAG CTAGGCTACCTGAATCAAACA