Skip to main content

Table 2 The list of primers for high resolution melting curve analysis for detection of beta-globin gene mutations

From: High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh

Sl No Primer name Primer sequence (5′ → 3′) Primer size
1 P1 ATGGTGCATCTGACTCCTGAG 21
2 R1 CCAATAGGCAGAGAGAGTCAGTG 23
3 P2 CACTGACTCTCTCTGCCTATTGG 23
4 R2 CAGGCCATCACTAAAGGCACC 21
  1. P1R1 = 1st set of primers for HRM; P2R2 = 2nd set of primers for HRM