Skip to main content

Table 3 Nucleotide sequences of primers used for promoter amplification and BS-PCR in this study

From: Comparative analyses of the Sox9a-Amh-Cyp19a1a regulatory Cascade in Autotetraploid fish and its diploid parent

Primer nameNucleotide sequence (5′ to 3′)
For promoter amplification
Sox9a-P1GACTCAGAGGAAAGCCAAGC
Sox9a-C1TCTTGAAGTCTGCGAGGCGG
Amh-P1GTTGGAAACCTTGGCTGTCT
Amh-C1GTCGCCACAATCAGCAACAG
Cyp19ala-P1TTAGCGATGAAAGTGGGCGT
Cyp19ala-C1TGTCCGATGGTGTCTGATGG
For BS-PCR
Sox9a-F3TATAAAAATGAATTTTGAAAGATGT
Sox9a-R3ATCTACAAATCATATTTCAATTTATC
Amh-F3TAGTATGATGTATAAAGATGAATGT
Amh-R3TACTCCTAGCCCTGATCTCTGGA
Cyp19ala-F3ACAACACCTCAAATAAACCCTAC
Cyp19ala-R3CAAAAAAACCTCACTAAAATACACC
  1. BS-PCR Bisulfite PCR