Skip to main content

Advertisement

Table 2 List of the 62 C. ensifolium genic-SSR primers including their unigenes annotation

From: Development of Cymbidium ensifoliumgenic-SSR markers and their utility in genetic diversity and population structure analysis in cymbidiums

Name Product size (bp) SSR SSR location Primer Homologs in non-redundant database (accession in Genebank) GO annotation KOG annotation KEGG annotation Allele number PIC
SSR01 400-500 (AC)8 utr5 F: AACGCCATGTCCAATACCC PREDICTED: probable transcription factor KAN2-like (XP_002278005.2) GO: 0003677 KOG1601 NULL 5 0.552
     R: GGAGGGCTTATTTGCAGCG       
SSR02 300-400 (AC)8 utr5 F: CTCCTTCAAGCTTCTGCCC PREDICTED: histone-lysine N-methyltransferase, H3 lysine-9, H3 lysine-27, H4 lysine-20 and cytosine specific SUVH2 (XP_002282386.1) GO: 0042393 NULL NULL NA NA
     R: GACCGCAGCGTTAATGACC       
SSR03 400-500 (AC)8 utr3 F: CTCGGTTCATTTGCAGCCC PREDICTED: mitochondrial import receptor subunit TOM20 (XP_002269795.1) GO: 0045040 NULL NULL 7 0.690
     R: GGGTGGGTATGGCGAAATC       
SSR04 400-500 (AC)8 utr3 F: AGAATCTGCCAACCCTTGATAC NULL NULL NULL NULL 6 0.657
     R: GCAGATGCCAGTTAGAATGGG      
SSR05 1000 (AC)8 utr3 F: AGAACTGCAGGTGTGAAGC PREDICTED: protein CbbY, chromosomal-like isoform 1 (XP_003574671.1) GO: 0016787 NULL NULL 3 0.125
     R: GGCTTGAAGTGGCGATAACC      
SSR06 600 (AC)9 utr3 F: GCGTCTGCTGAAACGATGG Putative steroid 22-alpha-hydroxylase (AAN60994.1) GO: 0016020 KOG0157 K09587 2 0.063
     R: AAACAGCGCCTGTCATTCC       
SSR07 300-400 (AC)9 utr3 F: ACGCTGCATCCCATTTCAC PREDICTED: uncharacterized protein LOC100243361 (XP_002276849.2) GO: 0008987 NULL K03517 4 0.180
     R: CAGTCTGTTGAGGAAGCCG       
SSR08 100-200 (AC)10 utr3 F: TGCTGGAATACATGCGAGAC Predicted protein (XP_002298559.1) GO: 0023014 KOG0610   14 0.753
     R: GTTTGCCGAAGCCAGTGC       
SSR11 600 (AG)10 utr3 F: AACTGACAAGCATCTGCAAG Uncharacterized protein LOC100273319 precursor (NP_001141232.1) GO: 0005774 NULL NULL 6 0.477
     R: CTGCTGCATTGGCCTTACC       
SSR12 300 (AG)11 utr5 F: TCAGCCGAGGTTAGTATACGG PREDICTED: phosphatidylinositol-4-phosphate 5-kinase 9-like (XP_002265706.1) GO: 0016020 KOG0229 K00889 NA NA
     R: CTTGCCATCTCAGCAGTCG       
SSR13 400-500 (AG)11 utr5 F: GCTGCTGCTTGGTGGAAAC Predicted protein (XP_002317724.1) GO: 0005488 NULL NULL 6 0.343
     R: GCGCTCGTTGTATGGCTTG       
SSR14 300 (AG)11 utr5 F: CACAGCAGCTCACAATCCTG Unnamed protein product (CBI20568.3) GO: 0006099 KOG1257 K00029 8 0.467
     R: TACAGCCCTGTTTACCGCC       
SSR15 100-200 (AG)11 utr3 F: CCTTCTCTCCGCGTACCAG PREDICTED: uncharacterized protein LOC100825549 (XP_003558805.1) GO: 0005783 NULL NULL 4 0.339
     R: CTTCGGTTGGCGTTTAGGG       
SSR16 300-400 (AG)11 utr5 F: GCCCACAGCAATCCATCTG PE repeat family protein (XP_003014087.1) NULL NULL NULL 7 0.348
     R: GCAGTCGAAGAAACCGTGG       
SSR17 400 (AG)11 utr5 F: GGATCACCAACAGCATGGG Transcription factor (ADG57844.1) GO: 0003677 NULL K09060 4 0.417
     R: TCCACCAAGAGCAAGGATG       
SSR18 300 (AG)11 utr5 F: TGAAACGGTTGGCTCTAGTTC Conserved hypothetical protein (XP_002527260.1) NULL NULL NULL 13 0.519
     R: AGCAAGCACTGACCTGAAAC      
SSR21 300-500 (GT)8 utr3 F: TGGGCGACAGATCGAGTTC Hypothetical protein OsJ_08996 (EAZ25197.1) NULL NULL NULL 15 0.794
     R: ACATGGACCACAGCATTCC       
SSR22 200-300 (GT)9 utr3 F: TATGCGTCTCTCCCAACCG 14-3-3-like protein B-like(ACQ45020.1) GO: 0019904 KOG0841 K06630 10 0.572
     R: AAGCTAGTGGCCTTTGGTG       
SSR23 100-200 (GT)10 utr3 F: CGGCGATCGATTTATGAGCC PREDICTED: beta-amylase 1, chloroplastic isoform 1 (XP_002285569.1) GO: 0005634 NULL K01177 NA NA
     R: CGATACTCCTCAATGTCGTGG      
SSR24 200-300 (GT)11 utr5 F: TCGGTAACCTGTTGCAAGG PREDICTED: flavin-containing monooxygenase YUCCA6-like (XP_003550114.1) GO: 0050661 NULL K11816 2 0.063
     R: ACCTGTGAAGCTACCAGAC       
SSR25 100-250 (GT)11 utr3 F: GAATCTCTCGCACCCGAAG Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B, putative (XP_002528338.1) GO: 0006536 NULL K02434 NA NA
     R: TGGACAACATCAAGTGACGC      
SSR26 100-250 (AAG)7 utr3 F: GCTTTATGCGACATCTGCG Unnamed protein product (CBI25980.3) GO: 0005634 KOG1901 NULL 11 0.638
     R: CGTCGGTTCCATGCACATC       
SSR27 500-600 (AGC)5 utr3 F: CTGCCTTCACAGCTAATGCC Os04g0512400 (NP_001053298.1) GO: 0046872 NULL NULL 3 0.313
     R: GCATGCTTGGACGCTGAAC       
SSR29 200-300 (AGC)6 utr3 F: AGCAAACGGCAAGTCATGG RING finger protein 113A, putative (XP_002522169.1) GO: 0016020 NULL K13127 2 0.033
     R: ATTCGACTACCAGCCGGAC       
SSR30 200-300 (AGG)5 utr3 F: AAACGAAGGGCTGGAAGTC NULL NULL NULL NULL 9 0.486
     R: TTTGACATCGGGAAGTGGC       
SSR31 100-200 (AGG)5 utr5 F: GGGATGCATAGACCTTTCGC Protein MSF1, putative (XP_002535293.1) GO: 0005739 KOG3336 NULL 2 0.033
     R: CAGGTTCAACGGCATCGTG       
SSR32 1000-1100 (AGG)5 utr3 F: CTCCGGCCTCTGGTTACTC PREDICTED: HVA22-like protein j (XP_002281038.1) NULL KOG1726 NULL 7 0.601
     R: AGTGATGAGGCTTGGACCG       
SSR34 700-900 (AGG)6 utr5 F: GAGAGGGAATTGCAGTGGC Hypothetical protein (BAI68347.1) NULL NULL NULL 6 0.696
     R: ACCGAGCTAGCACTTCATC       
SSR35 700-900 (ATC)5 utr5 F: AGAGTGATTGTCCAGCTCCG PREDICTED: diacylglycerol kinase-like (XP_003534537.1) GO: 0009395 NULL K07029 4 0.475
     R: TGCCTCTCTGGTGATGTCC       
SSR36 400-500 (ATC)5 utr3 F: AGTATTGGACCCTCCAGGC NULL NULL NULL NULL 5 0.536
     R: AGAGGATCATGGTGTTAGGC      
SSR37 200-300 (ATC)5 utr5 F: GGCCTAGCCAGCCCTTC NULL NULL NULL NULL 3 0.205
     R: ATTTGGATCGCACAAGCGG       
SSR38 200-300 (ATC)6 utr3 F: TAGCCCATGCCAGTGTTCC LOC100285373 (NP_001151738.1) GO: 0007165 NULL NULL 3 0.149
     R: AACTGCCACAAGAGAAGGC       
SSR39 1000-1100 (ATC)6 utr3 F: ACAGACTGCCACCTGTTCC unnamed protein product (CBI38283.3) GO: 0008234 KOG1870 K11835 5 0.401
     R: GCCTGCCTTTGCTCCTTG       
SSR40 400 (ATC)6 utr5 F: ACAAGCATCATCCCAAATTCC PREDICTED: probably inactive leucine-rich repeat receptor-like protein kinase At2g25790-like (XP_002267653.1) GO: 0007165 NULL NULL NA NA
     R: GCAGAAACTGGAGCTTGCC       
SSR42 200-300 (CCG)5 utr5 F: GACGACATATCGCGTTCGG unnamed protein product (CBI18667.3) GO: 0003779 KOG0160 NULL 6 0.564
     R: CTCAGCCACACCCAAGAGG       
SSR43 500 (CCG)5 utr5 F: GGAGCTGCATACGCAAGTG glycinebetaine/proline transporter (BAJ07206.1) GO: 0015193 NULL NULL 7 0.572
     R: AGCTTCTCACTGCCTCCAG       
SSR44 300-400 (CCG)5 utr5 F: CGTCGACTCCTCGAGATCC predicted protein (BAJ93650.1) GO: 0046872 NULL NULL NA NA
     R: GCGTTAGCAGCAGTCTTGG       
SSR45 400-500 (CCG)5 utr5 F: GCCTTACACATCCCTTCCAAC unnamed protein product (CBI33381.3) GO: 0005515 KOG0550 NULL 5 0.338
     R: TGCCTGCTGATAGTTTGCC       
SSR46 200-300 (CCG)6 utr5 F: CCTTCGTGGACTCAACAGC hypothetical protein SORBIDRAFT_01g031510 (XP_002465065.1) NULL NULL NULL 2 0.063
     R: TCTCGTGCAGGAATCGGTC       
SSR47 400-500 (CCG)6 utr3 F: GCAGGTGTCCTCATCGGAG CONSTANS-like protein (ADN97077.1) GO: 0005622 KOG1601 NULL NA NA
     R: CTCCGGCTAACTCCATCCC       
SSR49 300 (CCG)7 utr3 F: AGAGGGCCACCTGCTTTC predicted protein (XP_002312577.1) NULL KOG1863 NULL 6 0.549
     R: GCCAATTGCCAGATGGACG       
SSR52 400-500 (CCT)4 utr5 F: AAGAGGCACTGCAAGACCC hypothetical protein SORBIDRAFT_01g031070 (XP_002465040.1) NULL NULL NULL 8 0.378
     R: CGTTCCAGCAACCCATAGC       
SSR53 100-200 (CCT)4 utr5 F: GCTGAAGGTTCCGGTCCTC PREDICTED: uncharacterized protein LOC100830480 (XP_003580351.1) NULL NULL NULL 8 0.700
     R: TCCGCCTCTTTAAGCCGAC       
SSR54 200-300 (CCT)4 utr5 F: ATCTTCCCTCCACATCGGC hypothetical protein MTR_1g083540 (XP_003591171.1) GO: 0005886 NULL NULL 5 0.422
     R: TGGAGAAGAGTCGACCAGC       
SSR55 200-300 (CCT)4 utr5 F: TGGAATGGTTCTAGGGCTTC hypothetical protein (CCA65980.1) NULL NULL NULL 2 0.323
     R: CCACTGGTACCCTCCTTGG       
SSR56 900-1000 (CCT)5 utr5 F: TGCTTCATTGTTGGAGGCG predicted protein (XP_002324427.1) GO: 0008643 KOG0254 NULL 5 0.315
     R: AGTGGACGGAGAGTCAAGC       
SSR59 200-300 (CGG)5 utr3 F: GTTTCCAACGGTCAGCTCG leucine-rich repeat transmembrane protein kinase family protein (NP_177007.1) GO: 0005524 NULL NULL 3 0.432
     R: GTGATGTGGTAGCATCGCC       
SSR60 200-300 (CGG)5 utr5 F: TACGGTTTCGACCAGCCTC Unnamed protein product (CBI41056.3) GO: 0005634 KOG0265 K10143 4 0.203
     R: CCATGCAGATCGGGCAAAG       
SSR62 300-400 (CGG)6 utr5 F: GGTGGGTTAGACCAGCTCC Hypothetical protein OsI_29809 (EAZ07555.1) GO: 0005634 NULL NULL 6 0.570
     R: TCCTCAAGGCAAAGCTCCC       
SSR63 100-200 (CGG)6 utr5 F: CTTCCTCCACCTGGATCGC Uncharacterized protein LOC100277474(NP_001144494.1) GO: 0008270 NULL NULL 4 0.308
     R: CTGCCGATCAATCCGAGAC       
SSR64 400-500 (CGG)6 utr3 F: CGCTCAAAGAGATGGCACG Os01g0226200 (NP_001042462.1) NULL NULL NULL 11 0.627
     R: TAGTACGGCGCTGCTTGAG       
SSR66 300-400 (CGG)7 utr3 F: CATCTTCCTTGCCCGATGC PREDICTED: pentatricopeptide repeat-containing protein At5g42310, mitochondrial (XP_002272226.1) NULL KOG4197 NULL 4 0.126
     R: CCCGCCAAATTTCGAGACC       
SSR68 100-200 (GAT)5 utr3 F: CCAGATCGAATGGCTACGC Hypothetical protein VITISV_010525 (CAN79523.1) GO: 0003723 NULL NULL 4 0.211
     R: CAAGGAGCTCGTCGAAGG       
SSR69 200-300 (GAT)5 utr5 F: GTTTAGGCTAGCAGTGCGG NULL NULL NULL NULL 3 0.149
     R: TGAGAACGTAGTGAAGTTGCC      
SSR70 200-300 (GAT)7 utr3 F: CCCAACGCAGAACGATAGC NULL NULL NULL NULL 5 0.529
     R: CGGTGGCACAAATGGAACG       
SSR71 400-500 (GGT)5 utr5 F: GCATCGAAACCACTGTCGC Hypothetical protein SORBIDRAFT_09g018170 (XP_002439663.1) NULL NULL NULL 2 0.262
     R: CCCTAGCCGGAGTCTCAAC       
SSR73 100-200 (GGT)5 utr3 F: GGACACAATGGAGACGAAGG T4.15 (CCH50976.1) GO: 0044238 NULL NULL 16 0.863
     R: TGCATGAAACCACATGGC       
SSR75 400-500 (GTT)6 utr3 F: GCCTTTGACCATTCCGTGC Mitogen-activated protein kinase 1 (AEQ28763.1) GO: 0043622 KOG0660 K04371 2 0.118
     R: GGCCGCCATGAGTAAGAAC       
SSR76 500-600 (GTT)6 utr5 F: AGACAGAGAGTCCCTAAAGGC NULL NULL NULL NULL 7 0.519
     R: CAGGGATGTTAAGTGGGCTG      
SSR77 300-400 (GTT)6 utr3 F: TTTGTGGCAGTGGAAAGCG NULL NULL NULL NULL 5 0.470
     R: TGATACCAATGGCAAGGCG       
SSR79 200-300 (GTT)6 utr5 F: AGGATTCATGTAGCCGACCTC Hypothetical protein OsI_35425 (EEC67831.1) NULL NULL K10728 2 0.207
     R: TCCCTGAAGGAGGCAAACC       
SSR80 400-500 (GTT)7 utr3 F: GCACCCAGCTTGTTTGAGG NULL NULL NULL NULL 8 0.626
     R: CCCATACATTACAGGCAAGC      
  1. Note: A total of 62 genic-SSR markers successfully amplified were listed, however 55 polymorphic markers were used in subsequent population analysis or cross species comparison. NULL: no annotation. NA: monomorphic marker.