Skip to main content

Table 1 Sequences of primers for gene fragment isolation and PCR results

From: High resolution physical mapping of single gene fragments on pachytene chromosome 4 and 7 of Rosa

Gene Abbreviation Primers, 5′-3′ Location on Fragaria pseudo-chromosomes Expected length PCR product (bp) Length obtained PCR products (bp)
MLO-like protein MLO3 F: AAAACACCAACATGGGCAGT FvChr 7: 15397809..15393519 1675 1700
R: TTCCGAAAATCAAAGGTCGT
MLO-like protein MLO2 F: AGGATTTCAAGGTCGTGGTG FvChr6: 34503533..34507423 1852 1800
R: TGGTCGGCTAGCATTTTTCT
ATPase AAA-2 F: GTTCCCTTTGTCATTGCAG FvChr7: 21485846.. 21481090 2718 3400
R: ACGGCCTCTTCATCAATT
Ubiquitin protein ligase RIN-2 F: TCCTTCAGCTACACCATTGAC FvChr7: 19866961..19871497 2228 2500
R: AAATTGCGCGTTCCTACT
Monodehydroascorbate reductase MDAR F: GAGGCGGTATGGTTAATTT FvChr6: 12864594..12867898 2417 2800
R: AAACTTGGGCTTTGGTGA
Villin-2-like Villin F: CTCGCTTCTTCACAACATACT FvChr6: 33309900..33321407 3851 900
R:TTCACTGCCATTTTCATCCT
Mannosylglycoprotein endo-beta-mannosidase MGM F: CGGCATGGAAAATGAGTCAA FvChr6: 5180627..5186123 3017 3000
R: GAACAAAGGGATCTGCCA
Phenylalanine ammonia lyasea PAL F: ACCACTGGKTTTGGTGCWAC FvChr6:34874086–34877587 - 1700
R: CCYTTGAASCCATAATCCAA
Pyrroline-5-Carboxylate Synthasea P5CS F: GCTGGCATCCCTGTTGTTAT FvChr7: 17624431–17630820 - 1700
R: CTTCGGATCGCTAATGAAGC
  1. aData from [29]